ID: 1123208733

View in Genome Browser
Species Human (GRCh38)
Location 14:106738511-106738533
Sequence CTGGACCATATCAGTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208733_1123208741 13 Left 1123208733 14:106738511-106738533 CCAGATGCACTGATATGGTCCAG No data
Right 1123208741 14:106738547-106738569 CCAGGAACTGATGGGGACTTTGG No data
1123208733_1123208742 14 Left 1123208733 14:106738511-106738533 CCAGATGCACTGATATGGTCCAG No data
Right 1123208742 14:106738548-106738570 CAGGAACTGATGGGGACTTTGGG No data
1123208733_1123208737 4 Left 1123208733 14:106738511-106738533 CCAGATGCACTGATATGGTCCAG No data
Right 1123208737 14:106738538-106738560 ATGGCGAGTCCAGGAACTGATGG No data
1123208733_1123208735 -5 Left 1123208733 14:106738511-106738533 CCAGATGCACTGATATGGTCCAG No data
Right 1123208735 14:106738529-106738551 TCCAGACACATGGCGAGTCCAGG No data
1123208733_1123208739 6 Left 1123208733 14:106738511-106738533 CCAGATGCACTGATATGGTCCAG No data
Right 1123208739 14:106738540-106738562 GGCGAGTCCAGGAACTGATGGGG No data
1123208733_1123208743 15 Left 1123208733 14:106738511-106738533 CCAGATGCACTGATATGGTCCAG No data
Right 1123208743 14:106738549-106738571 AGGAACTGATGGGGACTTTGGGG No data
1123208733_1123208738 5 Left 1123208733 14:106738511-106738533 CCAGATGCACTGATATGGTCCAG No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208733 Original CRISPR CTGGACCATATCAGTGCATC TGG (reversed) Intergenic
No off target data available for this crispr