ID: 1123208738

View in Genome Browser
Species Human (GRCh38)
Location 14:106738539-106738561
Sequence TGGCGAGTCCAGGAACTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208726_1123208738 29 Left 1123208726 14:106738487-106738509 CCAGGGAGCCCCTTCCCTGGAGC No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data
1123208730_1123208738 15 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data
1123208733_1123208738 5 Left 1123208733 14:106738511-106738533 CCAGATGCACTGATATGGTCCAG No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data
1123208727_1123208738 21 Left 1123208727 14:106738495-106738517 CCCCTTCCCTGGAGCTCCAGATG No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data
1123208729_1123208738 19 Left 1123208729 14:106738497-106738519 CCTTCCCTGGAGCTCCAGATGCA No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data
1123208731_1123208738 14 Left 1123208731 14:106738502-106738524 CCTGGAGCTCCAGATGCACTGAT No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data
1123208728_1123208738 20 Left 1123208728 14:106738496-106738518 CCCTTCCCTGGAGCTCCAGATGC No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208738 Original CRISPR TGGCGAGTCCAGGAACTGAT GGG Intergenic
No off target data available for this crispr