ID: 1123208847

View in Genome Browser
Species Human (GRCh38)
Location 14:106739146-106739168
Sequence AAGCTGAGGGGGCTCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208847_1123208858 26 Left 1123208847 14:106739146-106739168 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123208858 14:106739195-106739217 GTGCTGGTAATTGGTGTCCCTGG No data
1123208847_1123208859 27 Left 1123208847 14:106739146-106739168 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123208859 14:106739196-106739218 TGCTGGTAATTGGTGTCCCTGGG No data
1123208847_1123208856 10 Left 1123208847 14:106739146-106739168 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123208856 14:106739179-106739201 TATTTTAAGGGAGACTGTGCTGG No data
1123208847_1123208853 -3 Left 1123208847 14:106739146-106739168 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123208853 14:106739166-106739188 CTTCCAAGTAGATTATTTTAAGG No data
1123208847_1123208857 17 Left 1123208847 14:106739146-106739168 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123208857 14:106739186-106739208 AGGGAGACTGTGCTGGTAATTGG No data
1123208847_1123208854 -2 Left 1123208847 14:106739146-106739168 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123208854 14:106739167-106739189 TTCCAAGTAGATTATTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208847 Original CRISPR AAGCTGAGGGGGCTCTCACA GGG (reversed) Intergenic
No off target data available for this crispr