ID: 1123210302

View in Genome Browser
Species Human (GRCh38)
Location 14:106753894-106753916
Sequence CCTCCTGTGCACCAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123210295_1123210302 7 Left 1123210295 14:106753864-106753886 CCAGCCCCTGAGAGGAAACCTTC No data
Right 1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG No data
1123210291_1123210302 20 Left 1123210291 14:106753851-106753873 CCCAAAGGAAGACCCAGCCCCTG No data
Right 1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG No data
1123210297_1123210302 2 Left 1123210297 14:106753869-106753891 CCCTGAGAGGAAACCTTCTCAGC No data
Right 1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG No data
1123210292_1123210302 19 Left 1123210292 14:106753852-106753874 CCAAAGGAAGACCCAGCCCCTGA No data
Right 1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG No data
1123210296_1123210302 3 Left 1123210296 14:106753868-106753890 CCCCTGAGAGGAAACCTTCTCAG No data
Right 1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG No data
1123210298_1123210302 1 Left 1123210298 14:106753870-106753892 CCTGAGAGGAAACCTTCTCAGCA No data
Right 1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG No data
1123210294_1123210302 8 Left 1123210294 14:106753863-106753885 CCCAGCCCCTGAGAGGAAACCTT No data
Right 1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123210302 Original CRISPR CCTCCTGTGCACCAGCTGCA GGG Intergenic
No off target data available for this crispr