ID: 1123210919

View in Genome Browser
Species Human (GRCh38)
Location 14:106760117-106760139
Sequence AGTAACAAAGGCACCCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123210919_1123210924 22 Left 1123210919 14:106760117-106760139 CCCTCGTGGGTGCCTTTGTTACT No data
Right 1123210924 14:106760162-106760184 GGCTGTCACGTGCTGCATGCAGG No data
1123210919_1123210922 1 Left 1123210919 14:106760117-106760139 CCCTCGTGGGTGCCTTTGTTACT No data
Right 1123210922 14:106760141-106760163 TTTTGTCCACAAGAGATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123210919 Original CRISPR AGTAACAAAGGCACCCACGA GGG (reversed) Intergenic