ID: 1123211154

View in Genome Browser
Species Human (GRCh38)
Location 14:106762171-106762193
Sequence GGGCAGAGTCACGATTACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123211154_1123211158 15 Left 1123211154 14:106762171-106762193 CCGCGGTAATCGTGACTCTGCCC No data
Right 1123211158 14:106762209-106762231 TAGTTTGCTGTACCAAAGATAGG No data
1123211154_1123211159 16 Left 1123211154 14:106762171-106762193 CCGCGGTAATCGTGACTCTGCCC No data
Right 1123211159 14:106762210-106762232 AGTTTGCTGTACCAAAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123211154 Original CRISPR GGGCAGAGTCACGATTACCG CGG (reversed) Intergenic