ID: 1123211154 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:106762171-106762193 |
Sequence | GGGCAGAGTCACGATTACCG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1123211154_1123211158 | 15 | Left | 1123211154 | 14:106762171-106762193 | CCGCGGTAATCGTGACTCTGCCC | No data | ||
Right | 1123211158 | 14:106762209-106762231 | TAGTTTGCTGTACCAAAGATAGG | No data | ||||
1123211154_1123211159 | 16 | Left | 1123211154 | 14:106762171-106762193 | CCGCGGTAATCGTGACTCTGCCC | No data | ||
Right | 1123211159 | 14:106762210-106762232 | AGTTTGCTGTACCAAAGATAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1123211154 | Original CRISPR | GGGCAGAGTCACGATTACCG CGG (reversed) | Intergenic | ||