ID: 1123211159

View in Genome Browser
Species Human (GRCh38)
Location 14:106762210-106762232
Sequence AGTTTGCTGTACCAAAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123211156_1123211159 -4 Left 1123211156 14:106762191-106762213 CCCTGGAACTTCTGTGCGTAGTT No data
Right 1123211159 14:106762210-106762232 AGTTTGCTGTACCAAAGATAGGG No data
1123211157_1123211159 -5 Left 1123211157 14:106762192-106762214 CCTGGAACTTCTGTGCGTAGTTT No data
Right 1123211159 14:106762210-106762232 AGTTTGCTGTACCAAAGATAGGG No data
1123211154_1123211159 16 Left 1123211154 14:106762171-106762193 CCGCGGTAATCGTGACTCTGCCC No data
Right 1123211159 14:106762210-106762232 AGTTTGCTGTACCAAAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123211159 Original CRISPR AGTTTGCTGTACCAAAGATA GGG Intergenic
No off target data available for this crispr