ID: 1123212010

View in Genome Browser
Species Human (GRCh38)
Location 14:106770492-106770514
Sequence CCTGTTCTGCAGAGGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123212002_1123212010 10 Left 1123212002 14:106770459-106770481 CCCTGGCAGGAAATGGCATCTCA No data
Right 1123212010 14:106770492-106770514 CCTGTTCTGCAGAGGTGGGGAGG No data
1123212003_1123212010 9 Left 1123212003 14:106770460-106770482 CCTGGCAGGAAATGGCATCTCAG No data
Right 1123212010 14:106770492-106770514 CCTGTTCTGCAGAGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123212010 Original CRISPR CCTGTTCTGCAGAGGTGGGG AGG Intergenic
No off target data available for this crispr