ID: 1123212018

View in Genome Browser
Species Human (GRCh38)
Location 14:106770540-106770562
Sequence TTCTTGTACAGGAGGCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123212014_1123212018 -3 Left 1123212014 14:106770520-106770542 CCACTGAGAAGCAGCCTGGGTTC No data
Right 1123212018 14:106770540-106770562 TTCTTGTACAGGAGGCGCCCTGG No data
1123212009_1123212018 25 Left 1123212009 14:106770492-106770514 CCTGTTCTGCAGAGGTGGGGAGG No data
Right 1123212018 14:106770540-106770562 TTCTTGTACAGGAGGCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123212018 Original CRISPR TTCTTGTACAGGAGGCGCCC TGG Intergenic
No off target data available for this crispr