ID: 1123212020

View in Genome Browser
Species Human (GRCh38)
Location 14:106770555-106770577
Sequence CGCCCTGGGCTGTGTCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123212017_1123212020 -2 Left 1123212017 14:106770534-106770556 CCTGGGTTCTTGTACAGGAGGCG No data
Right 1123212020 14:106770555-106770577 CGCCCTGGGCTGTGTCTCTGTGG No data
1123212014_1123212020 12 Left 1123212014 14:106770520-106770542 CCACTGAGAAGCAGCCTGGGTTC No data
Right 1123212020 14:106770555-106770577 CGCCCTGGGCTGTGTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123212020 Original CRISPR CGCCCTGGGCTGTGTCTCTG TGG Intergenic
No off target data available for this crispr