ID: 1123212473

View in Genome Browser
Species Human (GRCh38)
Location 14:106774109-106774131
Sequence CCATGCTGGATGGCAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123212467_1123212473 15 Left 1123212467 14:106774071-106774093 CCTGATTCAATCAGAGCATAACA No data
Right 1123212473 14:106774109-106774131 CCATGCTGGATGGCAGATGCAGG No data
1123212466_1123212473 25 Left 1123212466 14:106774061-106774083 CCTAGGTGTGCCTGATTCAATCA No data
Right 1123212473 14:106774109-106774131 CCATGCTGGATGGCAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123212473 Original CRISPR CCATGCTGGATGGCAGATGC AGG Intergenic
No off target data available for this crispr