ID: 1123214080

View in Genome Browser
Species Human (GRCh38)
Location 14:106790609-106790631
Sequence GGTTCCCGACCGCCCCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123214068_1123214080 16 Left 1123214068 14:106790570-106790592 CCCCCTGCACCTGCTCCTGGGAC No data
Right 1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG No data
1123214073_1123214080 1 Left 1123214073 14:106790585-106790607 CCTGGGACCTGTCCCGTCCTCAG No data
Right 1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG No data
1123214069_1123214080 15 Left 1123214069 14:106790571-106790593 CCCCTGCACCTGCTCCTGGGACC No data
Right 1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG No data
1123214072_1123214080 7 Left 1123214072 14:106790579-106790601 CCTGCTCCTGGGACCTGTCCCGT No data
Right 1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG No data
1123214075_1123214080 -6 Left 1123214075 14:106790592-106790614 CCTGTCCCGTCCTCAGTGGTTCC No data
Right 1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG No data
1123214065_1123214080 19 Left 1123214065 14:106790567-106790589 CCGCCCCCTGCACCTGCTCCTGG No data
Right 1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG No data
1123214071_1123214080 13 Left 1123214071 14:106790573-106790595 CCTGCACCTGCTCCTGGGACCTG No data
Right 1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG No data
1123214070_1123214080 14 Left 1123214070 14:106790572-106790594 CCCTGCACCTGCTCCTGGGACCT No data
Right 1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123214080 Original CRISPR GGTTCCCGACCGCCCCCTGG TGG Intergenic
No off target data available for this crispr