ID: 1123215253

View in Genome Browser
Species Human (GRCh38)
Location 14:106803251-106803273
Sequence CTGCTTTTCATCAGCAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123215249_1123215253 2 Left 1123215249 14:106803226-106803248 CCAGAGCTGCAGGGTCAGGGCTG No data
Right 1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG No data
1123215245_1123215253 8 Left 1123215245 14:106803220-106803242 CCTCTCCCAGAGCTGCAGGGTCA No data
Right 1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG No data
1123215241_1123215253 23 Left 1123215241 14:106803205-106803227 CCCAAGGCTGGAGCTCCTCTCCC No data
Right 1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG No data
1123215242_1123215253 22 Left 1123215242 14:106803206-106803228 CCAAGGCTGGAGCTCCTCTCCCA No data
Right 1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG No data
1123215248_1123215253 3 Left 1123215248 14:106803225-106803247 CCCAGAGCTGCAGGGTCAGGGCT No data
Right 1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123215253 Original CRISPR CTGCTTTTCATCAGCAAAAA GGG Intergenic
No off target data available for this crispr