ID: 1123215430

View in Genome Browser
Species Human (GRCh38)
Location 14:106804929-106804951
Sequence TCTCAACTCCATCGTGACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123215430_1123215436 1 Left 1123215430 14:106804929-106804951 CCACCGTCACGATGGAGTTGAGA No data
Right 1123215436 14:106804953-106804975 TCCAACATATGCCTTGTGGGGGG No data
1123215430_1123215435 0 Left 1123215430 14:106804929-106804951 CCACCGTCACGATGGAGTTGAGA No data
Right 1123215435 14:106804952-106804974 TTCCAACATATGCCTTGTGGGGG No data
1123215430_1123215440 26 Left 1123215430 14:106804929-106804951 CCACCGTCACGATGGAGTTGAGA No data
Right 1123215440 14:106804978-106805000 ATAACCCTTCAGTCAACAGGAGG No data
1123215430_1123215432 -3 Left 1123215430 14:106804929-106804951 CCACCGTCACGATGGAGTTGAGA No data
Right 1123215432 14:106804949-106804971 AGATTCCAACATATGCCTTGTGG No data
1123215430_1123215439 23 Left 1123215430 14:106804929-106804951 CCACCGTCACGATGGAGTTGAGA No data
Right 1123215439 14:106804975-106804997 GTCATAACCCTTCAGTCAACAGG No data
1123215430_1123215434 -1 Left 1123215430 14:106804929-106804951 CCACCGTCACGATGGAGTTGAGA No data
Right 1123215434 14:106804951-106804973 ATTCCAACATATGCCTTGTGGGG No data
1123215430_1123215433 -2 Left 1123215430 14:106804929-106804951 CCACCGTCACGATGGAGTTGAGA No data
Right 1123215433 14:106804950-106804972 GATTCCAACATATGCCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123215430 Original CRISPR TCTCAACTCCATCGTGACGG TGG (reversed) Intergenic
No off target data available for this crispr