ID: 1123215907

View in Genome Browser
Species Human (GRCh38)
Location 14:106809312-106809334
Sequence TTGTCCTAGATGAACTTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123215904_1123215907 6 Left 1123215904 14:106809283-106809305 CCTGTCATCACTTCTCTAGGTCA No data
Right 1123215907 14:106809312-106809334 TTGTCCTAGATGAACTTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123215907 Original CRISPR TTGTCCTAGATGAACTTGGT CGG Intergenic
No off target data available for this crispr