ID: 1123219365

View in Genome Browser
Species Human (GRCh38)
Location 14:106842050-106842072
Sequence GCTTCCACACTGGCAAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123219357_1123219365 25 Left 1123219357 14:106842002-106842024 CCTGGTTTACTGCACACAAGTCC No data
Right 1123219365 14:106842050-106842072 GCTTCCACACTGGCAAGAGAGGG No data
1123219361_1123219365 -6 Left 1123219361 14:106842033-106842055 CCTATATTCTCCAGACGGCTTCC No data
Right 1123219365 14:106842050-106842072 GCTTCCACACTGGCAAGAGAGGG No data
1123219359_1123219365 4 Left 1123219359 14:106842023-106842045 CCTGCACTGGCCTATATTCTCCA No data
Right 1123219365 14:106842050-106842072 GCTTCCACACTGGCAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123219365 Original CRISPR GCTTCCACACTGGCAAGAGA GGG Intergenic