ID: 1123220581

View in Genome Browser
Species Human (GRCh38)
Location 14:106851642-106851664
Sequence GCAACTATGCAAATTCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123220581_1123220585 -6 Left 1123220581 14:106851642-106851664 CCCACTTGAATTTGCATAGTTGC No data
Right 1123220585 14:106851659-106851681 AGTTGCCGCCCTGGCCTGAAGGG No data
1123220581_1123220584 -7 Left 1123220581 14:106851642-106851664 CCCACTTGAATTTGCATAGTTGC No data
Right 1123220584 14:106851658-106851680 TAGTTGCCGCCCTGGCCTGAAGG No data
1123220581_1123220590 8 Left 1123220581 14:106851642-106851664 CCCACTTGAATTTGCATAGTTGC No data
Right 1123220590 14:106851673-106851695 CCTGAAGGGAAGAGTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123220581 Original CRISPR GCAACTATGCAAATTCAAGT GGG (reversed) Intergenic
No off target data available for this crispr