ID: 1123220590

View in Genome Browser
Species Human (GRCh38)
Location 14:106851673-106851695
Sequence CCTGAAGGGAAGAGTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123220582_1123220590 7 Left 1123220582 14:106851643-106851665 CCACTTGAATTTGCATAGTTGCC No data
Right 1123220590 14:106851673-106851695 CCTGAAGGGAAGAGTCTACAAGG No data
1123220581_1123220590 8 Left 1123220581 14:106851642-106851664 CCCACTTGAATTTGCATAGTTGC No data
Right 1123220590 14:106851673-106851695 CCTGAAGGGAAGAGTCTACAAGG No data
1123220578_1123220590 30 Left 1123220578 14:106851620-106851642 CCTGGGTTTAAGTGGGGAGGCCC No data
Right 1123220590 14:106851673-106851695 CCTGAAGGGAAGAGTCTACAAGG No data
1123220579_1123220590 10 Left 1123220579 14:106851640-106851662 CCCCCACTTGAATTTGCATAGTT No data
Right 1123220590 14:106851673-106851695 CCTGAAGGGAAGAGTCTACAAGG No data
1123220580_1123220590 9 Left 1123220580 14:106851641-106851663 CCCCACTTGAATTTGCATAGTTG No data
Right 1123220590 14:106851673-106851695 CCTGAAGGGAAGAGTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123220590 Original CRISPR CCTGAAGGGAAGAGTCTACA AGG Intergenic
No off target data available for this crispr