ID: 1123223424

View in Genome Browser
Species Human (GRCh38)
Location 14:106877858-106877880
Sequence CCTTTTACACAGTCAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123223424_1123223430 14 Left 1123223424 14:106877858-106877880 CCAGCCACTGACTGTGTAAAAGG No data
Right 1123223430 14:106877895-106877917 GTCCAGGGCTCAGACTTTCCTGG 0: 4
1: 7
2: 7
3: 17
4: 186
1123223424_1123223428 -2 Left 1123223424 14:106877858-106877880 CCAGCCACTGACTGTGTAAAAGG No data
Right 1123223428 14:106877879-106877901 GGTGGCTGCTTTCTTTGTCCAGG 0: 11
1: 3
2: 6
3: 34
4: 219
1123223424_1123223429 -1 Left 1123223424 14:106877858-106877880 CCAGCCACTGACTGTGTAAAAGG No data
Right 1123223429 14:106877880-106877902 GTGGCTGCTTTCTTTGTCCAGGG 0: 5
1: 8
2: 4
3: 25
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123223424 Original CRISPR CCTTTTACACAGTCAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr