ID: 1123223428

View in Genome Browser
Species Human (GRCh38)
Location 14:106877879-106877901
Sequence GGTGGCTGCTTTCTTTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 11, 1: 3, 2: 6, 3: 34, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123223422_1123223428 15 Left 1123223422 14:106877841-106877863 CCTGCATCATGTAGCTCCCAGCC No data
Right 1123223428 14:106877879-106877901 GGTGGCTGCTTTCTTTGTCCAGG 0: 11
1: 3
2: 6
3: 34
4: 219
1123223424_1123223428 -2 Left 1123223424 14:106877858-106877880 CCAGCCACTGACTGTGTAAAAGG No data
Right 1123223428 14:106877879-106877901 GGTGGCTGCTTTCTTTGTCCAGG 0: 11
1: 3
2: 6
3: 34
4: 219
1123223423_1123223428 -1 Left 1123223423 14:106877857-106877879 CCCAGCCACTGACTGTGTAAAAG No data
Right 1123223428 14:106877879-106877901 GGTGGCTGCTTTCTTTGTCCAGG 0: 11
1: 3
2: 6
3: 34
4: 219
1123223427_1123223428 -6 Left 1123223427 14:106877862-106877884 CCACTGACTGTGTAAAAGGTGGC No data
Right 1123223428 14:106877879-106877901 GGTGGCTGCTTTCTTTGTCCAGG 0: 11
1: 3
2: 6
3: 34
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123223428 Original CRISPR GGTGGCTGCTTTCTTTGTCC AGG Intergenic
900125556 1:1067568-1067590 GGTGGCTGCTTTCTGGGCCACGG + Intergenic
900130522 1:1085310-1085332 GGTGCCTGCCCTCGTTGTCCAGG - Intronic
901039143 1:6353897-6353919 CGTGGCTGCCTTCTTTCTCTGGG + Intronic
901913027 1:12476128-12476150 TATGGCAGCTCTCTTTGTCCTGG + Intronic
902517312 1:16996386-16996408 TGTGGCTGCCCTCTCTGTCCTGG - Exonic
903371213 1:22837344-22837366 GATGCCTGCTTTCCTTGTGCTGG + Intronic
903579931 1:24363154-24363176 GGTGTCTGCTTTCTTAGCCAAGG + Intronic
904957143 1:34294289-34294311 GGTGTTTGGTTTTTTTGTCCTGG - Intergenic
905400501 1:37699285-37699307 GTTGCCTGCTTACTTTCTCCTGG + Intronic
906124191 1:43416620-43416642 TGTGGCTTGTTCCTTTGTCCAGG + Exonic
907427374 1:54388925-54388947 GGTGCCTTCTCACTTTGTCCTGG - Intronic
907527164 1:55060518-55060540 GGTGGCTGGTGCCCTTGTCCAGG + Intronic
907915560 1:58865689-58865711 GGTGTCTGCTTTCTTTGTGAAGG + Intergenic
911543008 1:99181863-99181885 ACTGGCTGCTTTATTTCTCCCGG - Intergenic
911554245 1:99323845-99323867 GCTGTCAGCTTTCCTTGTCCAGG + Intergenic
912000491 1:104828355-104828377 TGTGGTTCCTTTTTTTGTCCAGG - Intergenic
912153644 1:106888736-106888758 GGTGGCTGATGTCTTTTTCAGGG + Intergenic
913485027 1:119326436-119326458 GGGGGCCTCTTTCTATGTCCTGG - Intergenic
917303503 1:173603657-173603679 GGTGGCTGCTTTCTTTGTCCAGG + Intergenic
918610149 1:186480521-186480543 TGTGGCTGCTTTCTTTACCCTGG + Intergenic
918917524 1:190663813-190663835 GGAGTCAGTTTTCTTTGTCCAGG + Intergenic
920051287 1:203166505-203166527 GGTGCCTGCTCTCCTTGCCCTGG + Exonic
920104046 1:203537937-203537959 GATGGCTTCTTTCCTTGACCAGG - Intergenic
1062832414 10:614593-614615 GGTGGCTGTTGTCTTTGTGTCGG - Intronic
1062962316 10:1581918-1581940 AGTGGCTGTTTTCTCTGCCCTGG + Intronic
1063949120 10:11206171-11206193 GGGGCCTGCATTCTTAGTCCAGG + Intronic
1064430766 10:15268131-15268153 GGTGGCTTCTGTGGTTGTCCAGG - Intronic
1066688503 10:38003531-38003553 GGAGGCTGCATTCTTTGTCCAGG - Intergenic
1067004126 10:42645449-42645471 GGTGGCTGCATTCTTTCTCCAGG + Intergenic
1067222636 10:44355166-44355188 GGAGGCTGGTTGCTCTGTCCAGG - Intergenic
1067350009 10:45466918-45466940 TGTGGCTGCTTCCTTGATCCAGG - Intronic
1067530202 10:47065511-47065533 CATGCCTGCTATCTTTGTCCTGG - Intergenic
1069806567 10:71129005-71129027 GGGTTCTGCTTTCTCTGTCCCGG - Intergenic
1070794720 10:79209979-79210001 GGTGGCTGCTCGATTTGGCCCGG - Intronic
1071192915 10:83123274-83123296 GGTGGTGGCTGTCTTTGTCGTGG + Intergenic
1072251338 10:93584639-93584661 TGTGGCTGCTTGCTCTGTGCAGG - Intronic
1073454098 10:103626253-103626275 GGCGGCTGCTTACTTTGGCCTGG + Intronic
1074044053 10:109820489-109820511 GGTGGTTCCTTTCTTTGGCCAGG - Intergenic
1074594568 10:114849737-114849759 AGTGACTGCTTTATTTGTACCGG - Intronic
1074670279 10:115782521-115782543 GGTGGCTGATTTCATTCACCTGG + Intronic
1074852878 10:117452975-117452997 TGTGGCAGCTCTCTTGGTCCAGG + Intergenic
1075470290 10:122683704-122683726 GGTGGCCACTTTCTCTGCCCAGG - Intergenic
1077036835 11:499425-499447 AGAGGCTGGTTTCTTTCTCCCGG - Intronic
1077724314 11:4658860-4658882 GGTGGCTCCTTTCTTTGTCCAGG - Intergenic
1078663561 11:13306284-13306306 GGTGGCTGCTGCCTGTGTCCAGG + Intronic
1078876541 11:15404008-15404030 GCTGTCTGCTTTCTTTTTCCTGG + Intergenic
1083268838 11:61560475-61560497 GGTGGCTGCTGTCATCTTCCAGG + Intronic
1083366239 11:62143092-62143114 CTTGGCAGCTTTCTCTGTCCAGG + Intronic
1084317865 11:68355655-68355677 GGTGTCTGCTCACTTTGTCTTGG + Intronic
1084538658 11:69773861-69773883 TGGGGCTGCTTCCTTTGTCTGGG + Intronic
1085362350 11:75901646-75901668 GGTGGCTGCTACTTTTTTCCTGG + Intronic
1087117455 11:94541027-94541049 GGAGGCTGGTTTCTTTCTCTGGG - Intergenic
1089218662 11:116852341-116852363 GGTGGTTGCTTGCTCTGTCTTGG - Intronic
1090463340 11:126911226-126911248 GGTGGCTGCTTTTTATTTGCTGG - Intronic
1091045237 11:132319364-132319386 GGTCACTGCTTTCTTTGACTAGG - Intronic
1092144514 12:6205224-6205246 GGTATCTGCTTCCTTTGCCCAGG + Intronic
1093718979 12:22415718-22415740 GGTGGCTACTTGCATTGTCAAGG + Intronic
1095466477 12:42492504-42492526 GCTGGCTGTTTTCTTCTTCCAGG - Intronic
1096193319 12:49633804-49633826 GCTGGCTGGTTTCTCTATCCTGG - Intronic
1096917434 12:55048316-55048338 GGTGACTGCTTTCCCTGACCTGG + Intergenic
1098458075 12:70699083-70699105 GCTTGTTGCTTTATTTGTCCTGG - Intronic
1102438216 12:112941830-112941852 GGTGCCTGCCTTCAATGTCCTGG + Exonic
1102973187 12:117187557-117187579 GGTGGGTGATTGCTTTGGCCCGG - Intronic
1103340812 12:120220290-120220312 GGTGGCTGCTTTCTCTTGCTTGG - Intronic
1107490282 13:40874909-40874931 GGTGGCTGCTTTCTTTGTCCAGG + Intergenic
1109405286 13:61890012-61890034 CATGGCTCATTTCTTTGTCCTGG - Intergenic
1110553896 13:76836930-76836952 TGTGCCTGCTTTCTTTTCCCAGG + Intergenic
1112692243 13:101909987-101910009 GGTGTTTGGTTTTTTTGTCCTGG - Intronic
1113385366 13:109843148-109843170 TGTGGCTGCTTTCTCTTCCCTGG - Intergenic
1115064577 14:29242100-29242122 GGAGGCTGCTTTTTTTTTTCAGG - Intergenic
1118211333 14:63768631-63768653 GGCTGCTTCTTTCTTTGTCCTGG - Intergenic
1118775219 14:68969679-68969701 GGAGGCTGCCCTCTTTTTCCTGG + Intronic
1121196203 14:92074491-92074513 GGTGGCAGCTTTCTATGCCAAGG + Intronic
1121977382 14:98417808-98417830 GGTGGCTGCTGCCTTTGACATGG + Intergenic
1122279083 14:100610665-100610687 GGTGGTTGCTTTCCTTGGCCTGG - Intergenic
1123223428 14:106877879-106877901 GGTGGCTGCTTTCTTTGTCCAGG + Intergenic
1123666929 15:22615224-22615246 AGTGGCTGTTCTCATTGTCCTGG + Intergenic
1124286444 15:28403594-28403616 GGAGGTTGCTTTCTTTGACAAGG + Intergenic
1124296259 15:28508042-28508064 GGAGGTTGCTTTCTTTGACAAGG - Intergenic
1124320770 15:28709797-28709819 AGTGGCTGTTCTCATTGTCCTGG + Intronic
1124481723 15:30085552-30085574 AGTGGCTGTTCTCATTGTCCTGG - Intronic
1124488179 15:30137650-30137672 AGTGGCTGTTCTCATTGTCCTGG - Intronic
1124521867 15:30411648-30411670 AGTGGCTGTTCTCTTTGTCCTGG + Intronic
1124536797 15:30554571-30554593 AGTGGCTGTTCTCTTTGTCCTGG - Intronic
1124543270 15:30606624-30606646 AGTGGCTGTTCTCTTTGTCCTGG - Intronic
1124701250 15:31914433-31914455 GGTGACTGGTCTCCTTGTCCAGG - Intergenic
1124755347 15:32400670-32400692 AGTGGCTGTTCTCATTGTCCTGG + Intronic
1124761855 15:32453020-32453042 AGTGGCTGTTCTCTTTGTCCTGG + Intronic
1124776774 15:32596048-32596070 AGTGGCTGTTCTCTTTGTCCTGG - Intronic
1124960064 15:34387157-34387179 AGTGGCTGTTCTCATTGTCCTGG + Intronic
1124976693 15:34533378-34533400 AGTGGCTGTTCTCATTGTCCTGG + Intronic
1125556568 15:40590711-40590733 CGTGGCTACTTTCTTTGTCTGGG - Intergenic
1125612703 15:40982825-40982847 GGTGGCTGCAGACTTTGTTCTGG - Intronic
1125889543 15:43255386-43255408 GGTTGCTGCTTTCTCAGACCTGG - Intronic
1128599580 15:68984524-68984546 GGTGGCTGCTTTCTTTGTCCAGG + Intronic
1129036048 15:72648878-72648900 GCTGGCTGCTGTCTTTGGCCAGG + Intergenic
1129213838 15:74088338-74088360 GCTGGCTGCTGTCTTTGGCCAGG - Intergenic
1129400174 15:75277025-75277047 GCTGGCTGCTGTCTTTGGCCAGG + Intronic
1129730977 15:77932683-77932705 GCTGGCTGCTGTCTTTGGCCAGG - Intergenic
1129733444 15:77944759-77944781 GGTGGATGCTGTTTTTTTCCAGG - Intergenic
1130153590 15:81331161-81331183 GGTGGCTGCTTTCTTTATCCAGG - Intergenic
1130433601 15:83874160-83874182 GCTGCCCGCTTCCTTTGTCCTGG - Intronic
1131035458 15:89219013-89219035 GGGATCTGCTTTCTCTGTCCTGG + Exonic
1131527267 15:93162445-93162467 GGTGGCTGCTTTCTTTGTCCGGG - Intergenic
1131534284 15:93221669-93221691 GGTGGCTGCTTTCTTTGTCCGGG - Intergenic
1131549516 15:93344977-93344999 GGTGGCTGCTTTCTTTGTCCGGG + Intergenic
1131838459 15:96413041-96413063 GGAGGTTGGTTTCTCTGTCCAGG + Intergenic
1131932016 15:97453388-97453410 GCTGGCTTCATTCTTGGTCCAGG + Intergenic
1132209019 15:100006917-100006939 AGTGGCTGCTTCCTTTGGCCTGG - Intronic
1132433653 15:101779632-101779654 AGTGGCTGTTCTCATTGTCCTGG + Intergenic
1133337607 16:5016152-5016174 GGAGGCTGCTGTGTTTGCCCTGG + Exonic
1133597248 16:7304507-7304529 GGTGGCTGCTTTCCTGGGGCTGG + Intronic
1133677879 16:8092706-8092728 GATGGAGGCTTTGTTTGTCCTGG - Intergenic
1135078504 16:19414190-19414212 GGTCCCTGCTTTCTGTGTCTGGG + Intronic
1137749314 16:50847298-50847320 GGTGGCTGCTTCACTTGCCCTGG + Intergenic
1139352539 16:66346384-66346406 GGTATCTGCTTTGTCTGTCCAGG - Intergenic
1140456044 16:75106166-75106188 GGTGGCTGCTGCCATTCTCCTGG + Intronic
1141485829 16:84339709-84339731 GGTGGCTAAGCTCTTTGTCCAGG - Intergenic
1141697590 16:85627475-85627497 TGTGGCAGCTTTTTTTTTCCTGG + Intronic
1142105860 16:88302420-88302442 AGTGGCTGCTTCCTTTGGCCCGG + Intergenic
1142525167 17:535083-535105 GGTGGCTGCTGCCCTTGACCAGG + Intronic
1143596214 17:7915817-7915839 CGTCGCTGCTTTCCTTGGCCGGG + Intergenic
1144956067 17:19019540-19019562 AGTGACTGCAGTCTTTGTCCTGG + Exonic
1146160902 17:30559142-30559164 CGTGGCTGCCCTCTGTGTCCTGG + Exonic
1149614058 17:57983097-57983119 GGTGGGGGTTTTCTTTGGCCGGG + Exonic
1150489400 17:65563913-65563935 GGTGGCTGTGTTCTTGGCCCTGG - Intronic
1152320325 17:79605332-79605354 GGTGGCAGCTTTCTATGCTCAGG + Intergenic
1152547511 17:81009246-81009268 GGGGGGTGCTTTGTTTTTCCTGG - Intronic
1152983937 18:305185-305207 GCTAGCTGCTGTCTTTGTCTTGG + Intergenic
1153083153 18:1251932-1251954 GGTGTCTGCTGGCTTTTTCCAGG + Intergenic
1156580467 18:38369162-38369184 GGAGGTTGACTTCTTTGTCCAGG + Intergenic
1157323880 18:46655587-46655609 GGCGGATGCTTCCTTTTTCCTGG + Intronic
1157483653 18:48072409-48072431 GGTGGCTGCATCCATTGGCCAGG + Intronic
1159458469 18:68693408-68693430 GGTGGCTGCTTTCCAGGCCCCGG - Intronic
1160663847 19:313701-313723 GTTGGCTGCTTTGCTTGTCCTGG - Intronic
1162249486 19:9430293-9430315 GGTGGCTGCTTTCTTTGTCCAGG + Intronic
1163118435 19:15201267-15201289 GGAGGCTGTGTTTTTTGTCCCGG - Intergenic
1163686874 19:18716776-18716798 GGAGGCTTCTGTATTTGTCCAGG + Intronic
1164203266 19:23036107-23036129 GGTGGCTGCTTTCTTTGTCTGGG - Intergenic
1165979463 19:39707440-39707462 GGAGGCAGCTTTCATTGACCTGG + Intronic
1168439974 19:56356261-56356283 GGTGGCTGCTCTCTTTGTTCGGG - Intronic
925834985 2:7935810-7935832 GCTGGCTGCTCTCTTGGTCTTGG + Intergenic
926112020 2:10189554-10189576 AGTGGCTGCTTTCTTTGGTCTGG + Intronic
926852815 2:17219634-17219656 GGTGAATGCTTTCTGTGCCCAGG - Intergenic
927248957 2:20981182-20981204 GGTGACTCCTTTCCTTGTCCAGG - Intergenic
927691132 2:25209091-25209113 GATGGCTTCTTTCTTTGACAAGG - Intergenic
928272770 2:29871956-29871978 GCTGCCTGGTTTCTTTGGCCAGG - Intronic
928273840 2:29880966-29880988 CTTGGCTCCTTTCTCTGTCCGGG - Intronic
928878711 2:36072222-36072244 AGTGCCTGCTTTATTTGTACAGG + Intergenic
931981004 2:67694302-67694324 GGTGGGTGATTTATTTGTCATGG + Intergenic
932494560 2:72140019-72140041 GCTGGCTGCTGTATCTGTCCTGG - Intronic
933041224 2:77469227-77469249 GCTTGCTGCTTCCTTTGCCCAGG - Intronic
936611039 2:114002186-114002208 GTTGGCTGCTTTCTTTCCTCTGG + Intergenic
937014922 2:118596555-118596577 GTTGTCAGCTTTCTTTTTCCAGG + Intergenic
937065064 2:119011581-119011603 GGAGGTTGCTTTCTCTCTCCCGG + Intergenic
937888017 2:126913662-126913684 GGTTGCTGCTGTCCCTGTCCTGG - Intergenic
937976344 2:127584305-127584327 GGAAGCGGCTTTCTTCGTCCAGG - Exonic
937983355 2:127627612-127627634 GAAGGCTCCTTTCTTTGTCATGG + Intronic
938959631 2:136329574-136329596 GGGGGGTGCCTTCTTTATCCTGG + Intergenic
939983658 2:148810377-148810399 GGGGGCTGTTTTTTTAGTCCAGG + Intergenic
940637355 2:156315092-156315114 AGGGGCAACTTTCTTTGTCCAGG - Intergenic
941805131 2:169704494-169704516 GCTGGCTTCTTTCTGTTTCCTGG - Intronic
944330031 2:198454546-198454568 GTTGGCTGCTTCTGTTGTCCGGG - Intronic
946837856 2:223790052-223790074 TCAGGCTGCTCTCTTTGTCCTGG - Intronic
947637527 2:231687671-231687693 GGTGGCTGCTGTCCTAGTGCTGG - Intergenic
948280476 2:236743407-236743429 GGAGGCTGCCTTCCTCGTCCTGG + Intergenic
1170517160 20:17142630-17142652 GGTGGCTGCTTTCCTCATCAAGG + Intergenic
1171360390 20:24582815-24582837 GGTGGCTGCTTCATGTGTCTGGG - Intronic
1172169377 20:32919831-32919853 GGAAGATGCTTCCTTTGTCCTGG - Intronic
1172188124 20:33044152-33044174 GGTGGCTGCCTCCTTTGACAAGG + Intergenic
1172342628 20:34170361-34170383 GCTGGCTTCTTTCTTTTTTCTGG + Intergenic
1172767773 20:37359824-37359846 GGTGGCTGCTGCCTTAGTCTAGG + Intronic
1174750976 20:53111448-53111470 GGTGGCTGCTTTATCAGTCTGGG - Intronic
1175802024 20:61806338-61806360 GGTGCCTGGTCTCCTTGTCCTGG - Intronic
1176874553 21:14115402-14115424 GGTGGCTGCTTTCTTTGTCCGGG + Intronic
1176875685 21:14124679-14124701 GGTGGCTGCTTTCTTTGTCCGGG + Intronic
1178707702 21:34889029-34889051 GGGGCCTGCTTTCTTTTTCCAGG - Intronic
1179081444 21:38174267-38174289 TGTGGCTGCTTTCTTCTTCCAGG - Intronic
1179444997 21:41424831-41424853 GCTAGCTGCTTTCTTTGTTGGGG - Intronic
1182394656 22:30026559-30026581 GGGGGCTGCTTTCCTGGGCCAGG + Exonic
1182406365 22:30135592-30135614 GTTGCCAGTTTTCTTTGTCCAGG - Intronic
1183401817 22:37609175-37609197 GGAGGCTGCTCTCTCCGTCCCGG - Intronic
1183415326 22:37678495-37678517 GGTTGTTGCTGTCTTTGCCCAGG - Exonic
1183504386 22:38201307-38201329 GGAGGCTGCTGCCATTGTCCGGG + Intronic
949110582 3:255826-255848 GGTAGCTGTTTTGTTTGTCGTGG + Intronic
949771030 3:7578491-7578513 TGTGTCTTCTTTCTCTGTCCTGG - Exonic
950379576 3:12600183-12600205 GGTGCCCGCTCTCTTTGTGCTGG + Exonic
952984835 3:38770114-38770136 GGTTGTTGTTTTCTTTTTCCTGG + Intronic
953861666 3:46549494-46549516 GGTGGCTGTTTTCCTTATCTTGG + Intronic
956611947 3:71133147-71133169 GGTGGCAGCATTCTTTGTAGAGG - Intronic
960085019 3:113581413-113581435 GATGGCAGCTTTCTTGGTCATGG - Exonic
961009662 3:123427175-123427197 GCTGGCTGCTGCCCTTGTCCAGG - Intronic
961107407 3:124253814-124253836 GGGGGCTGGTTCCTTTGGCCTGG - Intronic
961161080 3:124726623-124726645 GGTGTCTCCTTATTTTGTCCAGG - Intergenic
961524382 3:127487313-127487335 GGTGGCTGCTGCAATTGTCCAGG - Intergenic
963289610 3:143474430-143474452 GGAGGCTGCCTTGTTAGTCCAGG + Intronic
965636148 3:170782985-170783007 CTTGCCTGATTTCTTTGTCCAGG - Intronic
965671943 3:171156677-171156699 GTTGGCTGCATGCCTTGTCCTGG - Intronic
967309857 3:188095516-188095538 TATGGCTCCTTTCTCTGTCCTGG - Intergenic
967512783 3:190331869-190331891 GGAGGCTCCATTCCTTGTCCTGG + Intronic
968103835 3:195987202-195987224 GGTTGCTGCTGGCTTTTTCCTGG + Intergenic
968183080 3:196611588-196611610 GGTGGCTTCTTTCTTTCCCTGGG + Intergenic
968302136 3:197624795-197624817 GGTTGCTGCTGGCTTTTTCCCGG + Intergenic
968975818 4:3821595-3821617 GGAGGCTGCTTTCTGTGGCCTGG + Intergenic
969080711 4:4615866-4615888 TGTGGCTGCTCTCTGGGTCCAGG + Intergenic
970642712 4:18085123-18085145 GGAGGCTGCTGTAATTGTCCAGG + Intergenic
972215417 4:36892234-36892256 TCTGGCTGCTTTGTTAGTCCTGG + Intergenic
973257703 4:48129667-48129689 GGTGGCTGCTGTCCGTGTCTGGG - Intronic
974558048 4:63478145-63478167 CCTGATTGCTTTCTTTGTCCTGG - Intergenic
978383390 4:108154819-108154841 GGATGCAGCTTTCTTTGTACAGG - Intronic
979888366 4:126060598-126060620 GGTGGCTGCATTCTTCCTTCTGG + Intergenic
981401445 4:144318600-144318622 ATTGGCTTATTTCTTTGTCCTGG + Intergenic
986111693 5:4725315-4725337 GGTGGCTTCTGTTTCTGTCCAGG - Intergenic
986993527 5:13580113-13580135 TGTGGCTTCCTTCTTTCTCCCGG + Intergenic
988560058 5:32272853-32272875 GGTGAATGCTCTCTTTGTACAGG + Intronic
989196455 5:38721390-38721412 GCTGGCTGCTGTGTTTGTCAGGG + Intergenic
992020754 5:72621306-72621328 GTTGGATGCTTTCATTGTACAGG - Intergenic
996058781 5:119009854-119009876 GCTGGCCTCTTTCTTTGACCTGG + Intergenic
996157978 5:120127116-120127138 GGTGTTTGGTTTCTTTGTCCTGG + Intergenic
997312249 5:132896815-132896837 GGTGGCTGCTTTGTGTCTGCTGG + Exonic
997744050 5:136283253-136283275 GGTGTCTGCTTTCTTTGCAAAGG + Intronic
999186027 5:149709648-149709670 GGAGGCTGCTGTAATTGTCCAGG + Intergenic
1001636712 5:173215333-173215355 GGTGGGTGCTTTCTATGTGCAGG + Intergenic
1002058826 5:176614134-176614156 GGTGGCTGCTGTCTCTGCTCTGG - Intergenic
1006255362 6:32828661-32828683 GGTGGGGGCTGTCTGTGTCCAGG - Intronic
1006598126 6:35208473-35208495 GCTGGCTGCTTTCTCTCTGCTGG - Intergenic
1009259317 6:61463764-61463786 GGTGGTTGCTGTGTTTATCCTGG - Intergenic
1010646539 6:78395523-78395545 TGTGGTTGCTTTCTTTGGGCAGG + Intergenic
1010765448 6:79773461-79773483 GGTGGATGTTTTCTTTTTCAGGG - Intergenic
1013211550 6:107991446-107991468 GGTGGCTGCTTTCTTTGTCCGGG + Intergenic
1014049106 6:116930983-116931005 GGAGGCTGCTGTGTTGGTCCAGG + Intronic
1017412721 6:154186461-154186483 GGTGGCTGCTGCCTGTGTTCAGG - Intronic
1017514063 6:155140155-155140177 AGTGTCTCCTTTCTTTGCCCTGG + Intronic
1017870163 6:158480172-158480194 GGTGGCTGTTATCTTTCTCATGG + Intronic
1019093241 6:169557487-169557509 GAGGGCTCCTTTCTTTGTCTGGG - Intronic
1019101927 6:169638593-169638615 GGTGGCTGCTCTCTGCGGCCCGG - Exonic
1019661375 7:2225861-2225883 GGTGGCTGCATTCTCTGACCAGG + Intronic
1019746878 7:2705713-2705735 GGTGGCATGTTTCTTTGTCCTGG + Intronic
1020178077 7:5898742-5898764 GGTGGCTGCTGTCTCTGGGCGGG + Exonic
1020304850 7:6826233-6826255 GGTGGCTGCTGTCTCTGGGCGGG - Exonic
1021138137 7:16991242-16991264 TGTGGCTGCTTTATTTCTCCTGG + Intergenic
1022245671 7:28556871-28556893 GTTGGCTGCTTTCTTTGACCAGG + Intronic
1022451922 7:30523675-30523697 AGTGGCTGTTCTCATTGTCCTGG + Intronic
1023718870 7:43072574-43072596 AGTGGCTGTTTTCTTTGTCCGGG - Intergenic
1025070736 7:55896140-55896162 GGTGGCTTCTCTCATTGTCTTGG - Intronic
1026808693 7:73444225-73444247 GGCCACTGCTTTCCTTGTCCAGG - Intronic
1028867835 7:95734249-95734271 GGTGGATGCTTTCTTTGTGAGGG + Intergenic
1029080779 7:97972290-97972312 GGTGGCTGCTTTCTCTGGGCTGG - Intergenic
1029113052 7:98223245-98223267 GTTGGCTGCTTTCCTCCTCCTGG - Intronic
1029451754 7:100645415-100645437 GGAGGCTGTTTTGATTGTCCCGG - Intronic
1031761679 7:125720680-125720702 GGTGCCTGATTTCTGTGGCCAGG - Intergenic
1033705310 7:143880941-143880963 GCTTCCTGCTTTCTTTCTCCTGG + Intronic
1035024950 7:155819188-155819210 GGTGGCTTGTTTCTTTCTCTGGG + Intergenic
1036595411 8:10207293-10207315 GGAGGCTGGTGTCTTTGGCCTGG + Intronic
1039268822 8:35858086-35858108 CGTGGCTGCTTTGCTTATCCTGG + Intergenic
1039509797 8:38081921-38081943 GGTGGCTGCTTTCTTTGCCGAGG - Intergenic
1041516645 8:58706864-58706886 GGTGTCTCCTTACATTGTCCAGG + Intergenic
1042350401 8:67771703-67771725 GGTGACTCCTGTGTTTGTCCTGG + Intergenic
1042367051 8:67949569-67949591 GGTTGTTGCTTTCCTTTTCCTGG + Intergenic
1044316436 8:90754048-90754070 GGTGGCTGCTGACTCTGCCCTGG + Intronic
1044770986 8:95633775-95633797 TGTGGCTGCTTTCTCTTACCAGG - Intergenic
1045280912 8:100749068-100749090 AGTTGGTGCTTTCTTTGTGCTGG + Intergenic
1045488364 8:102651804-102651826 GCTGGCTGCTTTCATTGGGCAGG + Exonic
1051055988 9:12986653-12986675 GGTGGCTGCCTTGTTTATGCTGG - Intergenic
1051095091 9:13457245-13457267 GATGGCTACTGTCTTGGTCCAGG - Intergenic
1054362726 9:64192656-64192678 GGTGGTTGCTGTGTTTATCCTGG - Intergenic
1056456345 9:86764570-86764592 GGTGGCTTCTGTCACTGTCCAGG - Intergenic
1060766064 9:126295859-126295881 GATGGCTGCTCTCTTTTTCCTGG - Intergenic
1186131446 X:6470296-6470318 GGTGGTTTCTTGCTTTTTCCAGG - Intergenic
1188034593 X:25303249-25303271 GGTGTTTGGTTTTTTTGTCCTGG - Intergenic
1188359390 X:29233882-29233904 CATGGCTGCTTACTTTGTCAAGG - Intronic
1199320359 X:146430815-146430837 GGGGGCTGGTTTCTTTGTAGGGG + Intergenic
1201539144 Y:15087341-15087363 GGTTGCTGTTTCCTTTGTTCGGG - Intergenic