ID: 1123223429

View in Genome Browser
Species Human (GRCh38)
Location 14:106877880-106877902
Sequence GTGGCTGCTTTCTTTGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 5, 1: 8, 2: 4, 3: 25, 4: 245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123223424_1123223429 -1 Left 1123223424 14:106877858-106877880 CCAGCCACTGACTGTGTAAAAGG No data
Right 1123223429 14:106877880-106877902 GTGGCTGCTTTCTTTGTCCAGGG 0: 5
1: 8
2: 4
3: 25
4: 245
1123223427_1123223429 -5 Left 1123223427 14:106877862-106877884 CCACTGACTGTGTAAAAGGTGGC No data
Right 1123223429 14:106877880-106877902 GTGGCTGCTTTCTTTGTCCAGGG 0: 5
1: 8
2: 4
3: 25
4: 245
1123223423_1123223429 0 Left 1123223423 14:106877857-106877879 CCCAGCCACTGACTGTGTAAAAG No data
Right 1123223429 14:106877880-106877902 GTGGCTGCTTTCTTTGTCCAGGG 0: 5
1: 8
2: 4
3: 25
4: 245
1123223422_1123223429 16 Left 1123223422 14:106877841-106877863 CCTGCATCATGTAGCTCCCAGCC No data
Right 1123223429 14:106877880-106877902 GTGGCTGCTTTCTTTGTCCAGGG 0: 5
1: 8
2: 4
3: 25
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123223429 Original CRISPR GTGGCTGCTTTCTTTGTCCA GGG Intergenic
900130521 1:1085309-1085331 GTGCCTGCCCTCGTTGTCCAGGG - Intronic
900719235 1:4164592-4164614 TTGCTTGCTTTCTTTGTCCATGG + Intergenic
902517311 1:16996385-16996407 GTGGCTGCCCTCTCTGTCCTGGG - Exonic
905287097 1:36888600-36888622 GTGGCTGGTTCCTGTGACCATGG - Intronic
905662469 1:39738107-39738129 GTGGCTGCTTTCCTACTACAAGG - Intronic
907230670 1:52995641-52995663 GTGGCTGCTGTCTTTGTGGATGG + Intronic
907527165 1:55060519-55060541 GTGGCTGGTGCCCTTGTCCAGGG + Intronic
907988323 1:59554584-59554606 GTGTCTGTTTTCCTTGGCCAGGG + Intronic
908336509 1:63130654-63130676 CTGGGTGCTTTCTTTGTGCCAGG - Intergenic
909259169 1:73464879-73464901 GTGTCTGCGTTCCTTTTCCATGG - Intergenic
910643023 1:89484759-89484781 GAATCTGCTTTCTTTGTCCCTGG + Intergenic
910662382 1:89687675-89687697 TTGGCTGCCATCATTGTCCATGG - Intronic
911013122 1:93302809-93302831 CTGGCTGTTTTGTTAGTCCAAGG - Intergenic
914980414 1:152410158-152410180 GTGGCTGCTGTCCTGCTCCACGG + Exonic
917303504 1:173603658-173603680 GTGGCTGCTTTCTTTGTCCAGGG + Intergenic
919805467 1:201378767-201378789 GAGATTGCTTTCTTTGCCCACGG - Intronic
920713994 1:208322234-208322256 GTCCCTGCTTTCTCTATCCAGGG + Intergenic
921165845 1:212506440-212506462 GTGGTTGATTTCTAAGTCCATGG + Intergenic
922319846 1:224477090-224477112 GAGGCTGCTTGCTTTCTCAATGG - Intronic
922729882 1:227944320-227944342 TTGTCTGCGTTCTTTCTCCACGG - Intronic
922920283 1:229295994-229296016 GTGTGTGCTTTGTGTGTCCAGGG + Intronic
923358858 1:233188134-233188156 GTGGCTGCGTCCTCTGCCCAGGG + Intronic
1063949121 10:11206172-11206194 GGGCCTGCATTCTTAGTCCAGGG + Intronic
1063964927 10:11339457-11339479 GTGGCTCCTGACTTTGGCCAGGG - Intergenic
1064971317 10:21069973-21069995 GTGGCTGCATTCTGGCTCCAGGG - Intronic
1065713797 10:28544611-28544633 GCTGCTGCTTTCTTTGTTTAGGG + Intronic
1065854700 10:29820895-29820917 ATGGCAGCCTTCTTTGTCCCTGG - Intergenic
1066688502 10:38003530-38003552 GAGGCTGCATTCTTTGTCCAGGG - Intergenic
1067004127 10:42645450-42645472 GTGGCTGCATTCTTTCTCCAGGG + Intergenic
1067149088 10:43714917-43714939 TTGGCTGCTTTGTTTGCACAGGG - Intergenic
1067222635 10:44355165-44355187 GAGGCTGGTTGCTCTGTCCAGGG - Intergenic
1067817589 10:49494066-49494088 GTGGGTGCTACCTATGTCCATGG + Intronic
1068556779 10:58467163-58467185 GTGGCTGCTATTTTTTTCCCAGG + Intergenic
1069115700 10:64503490-64503512 TTGGCTGTTTCCTTTTTCCATGG + Intergenic
1070990705 10:80729829-80729851 GTGGCTGGATTCTTTGCTCAGGG - Intergenic
1072062200 10:91824309-91824331 GTGACTGCTTTCCATGACCAGGG + Intronic
1072899452 10:99394332-99394354 GTGGCTGTTTTCCTTGCCCCTGG + Intergenic
1074044052 10:109820488-109820510 GTGGTTCCTTTCTTTGGCCAGGG - Intergenic
1074594567 10:114849736-114849758 GTGACTGCTTTATTTGTACCGGG - Intronic
1074752459 10:116599867-116599889 GAGGGTGCTTTCTGTGTACAAGG - Intronic
1075085622 10:119412585-119412607 GTGGTTCCTTTCTCTGTCCATGG - Intronic
1075941730 10:126395800-126395822 GTTCCAGCTTTCTTTGTCCTAGG + Intergenic
1076208706 10:128623628-128623650 GTGGCTGGTTTCGTTGGCCACGG + Intergenic
1077036834 11:499424-499446 GAGGCTGGTTTCTTTCTCCCGGG - Intronic
1077411321 11:2405219-2405241 GGGGCTGCTTTCCTAGTCCCAGG - Intronic
1078161547 11:8843882-8843904 TTGGTTGCTTTCTCTGGCCATGG + Intronic
1079277518 11:19055814-19055836 GTGGCTGATTTTTTTATTCATGG - Exonic
1079797360 11:24822635-24822657 GTGGATGAATTTTTTGTCCAGGG + Intronic
1080877983 11:36294262-36294284 CTGGCTGCCTTCTTTGTCAGAGG + Intergenic
1081099358 11:38982811-38982833 GTGACTGCTCTTCTTGTCCAAGG - Intergenic
1081152348 11:39648036-39648058 GTGGCTGCTCAGCTTGTCCAAGG - Intergenic
1083366240 11:62143093-62143115 TTGGCAGCTTTCTCTGTCCAGGG + Intronic
1083783842 11:64932706-64932728 GTGGCTTCTCTCTGTGTGCAAGG - Intronic
1084538659 11:69773862-69773884 GGGGCTGCTTCCTTTGTCTGGGG + Intronic
1084798175 11:71523191-71523213 GAGGCTACTTTCTTTGTTTAAGG - Intronic
1085280650 11:75328131-75328153 GTGTCTGCTTTCTGTCTCTATGG + Intronic
1085742363 11:79088192-79088214 GGGGCTGCTTGCTCTCTCCAGGG + Intronic
1088200975 11:107333954-107333976 ATGGCTGCTTTCATGGTACAAGG - Intronic
1091965150 12:4734548-4734570 TTCGCTTCTTTCTTTCTCCAGGG + Intronic
1094268298 12:28583723-28583745 GTTGTTGGTTTCTTTTTCCATGG + Intergenic
1094342514 12:29428730-29428752 TTTGATGCTTTCTTTTTCCAGGG - Intronic
1095592093 12:43915028-43915050 CTGGCTGCTTTCTTTCCTCATGG + Intronic
1096536861 12:52280435-52280457 GTTTCTGCTTTCTATGTCCCTGG + Intronic
1097023159 12:56034940-56034962 GTGGTTGCTTTCTGTGTCTGTGG - Exonic
1097363555 12:58685418-58685440 GTGGTTTCCTTCTTTGTACAAGG + Intronic
1097522167 12:60682815-60682837 GTGGAAGCATACTTTGTCCATGG - Intergenic
1098139158 12:67433948-67433970 GTGGTTGCTTTATTTGCACATGG - Intergenic
1098432920 12:70440218-70440240 GTGTCTGCTTTCTTTGGGGAGGG + Intergenic
1100236895 12:92670520-92670542 GTGGCTGCTTTCACTGTTAAAGG - Intergenic
1101248961 12:102912965-102912987 GTTCATGCTTGCTTTGTCCATGG - Intronic
1102327334 12:111998458-111998480 ATGGCTGCTTTTCTTCTCCAGGG - Intronic
1104934816 12:132358785-132358807 GTGGCTGCTGTCCACGTCCACGG - Intergenic
1106923424 13:34588723-34588745 GTGGCTCCTTCCTTAGCCCAGGG - Intergenic
1107346723 13:39469414-39469436 GTGGCTGATATCTTTCTTCATGG + Intronic
1107386411 13:39914529-39914551 GTTGCTGGTTTCTTTGTCTGTGG - Intergenic
1107490283 13:40874910-40874932 GTGGCTGCTTTCTTTGTCCAGGG + Intergenic
1107939620 13:45372332-45372354 GTTCCTGCTTTCTCTCTCCACGG - Intergenic
1108454897 13:50603584-50603606 GTAGCTGCTTTCTTTCTTTAGGG + Intronic
1108745295 13:53387339-53387361 GTGGCTGCTTTCATGTTACAAGG + Intergenic
1110553897 13:76836931-76836953 GTGCCTGCTTTCTTTTCCCAGGG + Intergenic
1110584893 13:77177794-77177816 GTGGTTGGTTTCTCTGTCTATGG - Exonic
1112555929 13:100468704-100468726 GTGGCTGGTTTGATTGTCTATGG + Intronic
1113179920 13:107613046-107613068 GTGGCTGCTCCCTTCCTCCAGGG - Intronic
1114169662 14:20259454-20259476 TTGGCTGCTTACTTTTTCCTAGG + Intronic
1115805940 14:37051743-37051765 GTTGCTGTGGTCTTTGTCCAAGG + Intronic
1116864097 14:50017399-50017421 ATGGCTGCTTTCTCTCTTCATGG + Intergenic
1122006601 14:98709916-98709938 GTGGCTGCTTTCCTGATACAAGG - Intergenic
1122114211 14:99519854-99519876 GTTGGTGCTTTCTGTTTCCACGG - Intronic
1122807453 14:104267173-104267195 GTGGCTGCTCTCCCTTTCCAAGG + Intergenic
1123223429 14:106877880-106877902 GTGGCTGCTTTCTTTGTCCAGGG + Intergenic
1125034950 15:35112456-35112478 GTGGCTTCCTTCTCAGTCCAGGG + Intergenic
1125556567 15:40590710-40590732 GTGGCTACTTTCTTTGTCTGGGG - Intergenic
1125680082 15:41525006-41525028 GTGGCTGCCTCCTATGGCCAGGG - Exonic
1126936789 15:53719028-53719050 GTGGCTGATGTATTTATCCATGG - Intronic
1128599581 15:68984525-68984547 GTGGCTGCTTTCTTTGTCCAGGG + Intronic
1129028684 15:72603537-72603559 GTATCTGCTATCTTTGACCATGG - Intergenic
1129125883 15:73440928-73440950 GTTGGTGCTTTCTATTTCCAGGG - Intergenic
1129133883 15:73528733-73528755 GTGGCTGCTTTCGTGCTACAAGG + Intronic
1129482309 15:75837323-75837345 GTGGGTGCTTTCTATGTCCCAGG + Intergenic
1129680676 15:77656839-77656861 GGAGCTGGTTTCTTTGTCCCTGG + Intronic
1129733443 15:77944758-77944780 GTGGATGCTGTTTTTTTCCAGGG - Intergenic
1130153589 15:81331160-81331182 GTGGCTGCTTTCTTTATCCAGGG - Intergenic
1130312705 15:82769096-82769118 GTGGCTGTGATGTTTGTCCATGG - Intronic
1131235954 15:90697339-90697361 GTGGCTGCATCCTTTGCCCAAGG - Intergenic
1131443236 15:92474507-92474529 GGGGCTGCTTTCTCAGGCCAAGG + Intronic
1131527266 15:93162444-93162466 GTGGCTGCTTTCTTTGTCCGGGG - Intergenic
1131534283 15:93221668-93221690 GTGGCTGCTTTCTTTGTCCGGGG - Intergenic
1131549517 15:93344978-93345000 GTGGCTGCTTTCTTTGTCCGGGG + Intergenic
1131932017 15:97453389-97453411 CTGGCTTCATTCTTGGTCCAGGG + Intergenic
1132465521 16:75701-75723 GTGGCTGCCTTCTCTGCCCAAGG + Intronic
1133502465 16:6378951-6378973 ATTGCTACTTTCTTTTTCCAGGG - Intronic
1134831960 16:17331051-17331073 GTGGCTGCCTGCTCTGCCCATGG - Intronic
1135025795 16:18998098-18998120 GTGGCTGCTTTCCTGCTACAAGG + Intronic
1137630924 16:49944190-49944212 GTGGCTGTTTGCTTTCTCCCAGG - Intergenic
1139352538 16:66346383-66346405 GTATCTGCTTTGTCTGTCCAGGG - Intergenic
1140343021 16:74184172-74184194 GTAGCAGCTTTCTTTGTTCTTGG - Intergenic
1141485828 16:84339708-84339730 GTGGCTAAGCTCTTTGTCCAGGG - Intergenic
1141628837 16:85275956-85275978 GGGGGTGCTTTCTATGTCCTTGG + Intergenic
1141697591 16:85627476-85627498 GTGGCAGCTTTTTTTTTCCTGGG + Intronic
1142525168 17:535084-535106 GTGGCTGCTGCCCTTGACCAGGG + Intronic
1144956068 17:19019541-19019563 GTGACTGCAGTCTTTGTCCTGGG + Exonic
1146620096 17:34390540-34390562 GTGGCTGCTTGTTTTCTTCAGGG - Intergenic
1149690093 17:58568249-58568271 TTGGTTTCTTTCTTTTTCCATGG - Intronic
1152687496 17:81701803-81701825 GTCTCTGCTTTCTTTCCCCAGGG + Exonic
1153083154 18:1251933-1251955 GTGTCTGCTGGCTTTTTCCAGGG + Intergenic
1154965197 18:21348993-21349015 GTGGCTGCCCTCTGTCTCCAGGG + Intronic
1156580468 18:38369163-38369185 GAGGTTGACTTCTTTGTCCAGGG + Intergenic
1157035565 18:43969019-43969041 ATGGCTGCTTTCTTACTCAAGGG - Intergenic
1158781790 18:60661554-60661576 TTGGTTGTTTTCCTTGTCCATGG - Intergenic
1159726307 18:71964325-71964347 GTGGTTGTTTTCTTTGTCTTTGG + Intergenic
1160467767 18:79096323-79096345 GAGGCTGCTTTCTTTTGCAAAGG - Intronic
1162249487 19:9430294-9430316 GTGGCTGCTTTCTTTGTCCAGGG + Intronic
1163802846 19:19377806-19377828 GGCACTGCTTCCTTTGTCCAAGG + Intergenic
1164041195 19:21494098-21494120 GTGACTGTTTTCTTTTTCCTAGG + Intergenic
1164203265 19:23036106-23036128 GTGGCTGCTTTCTTTGTCTGGGG - Intergenic
1168192769 19:54751848-54751870 GTGGCTGCTGCCTTGGGCCAGGG - Intronic
1168194856 19:54766676-54766698 GTGGCTGCTGCCTTGGGCCAGGG - Intronic
1168197105 19:54783118-54783140 GTGGCTGCTGCCTTGGGCCAGGG - Intronic
1168202903 19:54829560-54829582 GTGGCTCCTGTCTTGGGCCAGGG - Intronic
1168205465 19:54847383-54847405 GTGGCTCCTGTCTTGGGCCAGGG - Intronic
1168439973 19:56356260-56356282 GTGGCTGCTCTCTTTGTTCGGGG - Intronic
1168463878 19:56586410-56586432 GTGGCTGGTTCCTTTATACAAGG - Intronic
925388215 2:3478233-3478255 CTGGCTGCAGGCTTTGTCCAAGG - Intronic
926112021 2:10189555-10189577 GTGGCTGCTTTCTTTGGTCTGGG + Intronic
926421622 2:12705327-12705349 ATGGCAGCTTGCTTTATCCAGGG - Intergenic
926623068 2:15065696-15065718 GTTGTAGTTTTCTTTGTCCAAGG - Intergenic
927508491 2:23629644-23629666 GTGGTTGCTTTATGTGTGCAAGG + Intronic
927691131 2:25209090-25209112 ATGGCTTCTTTCTTTGACAAGGG - Intergenic
928273839 2:29880965-29880987 TTGGCTCCTTTCTCTGTCCGGGG - Intronic
930437576 2:51364663-51364685 GTGTTTGTTTTCTTTGTCCTTGG - Intergenic
933624019 2:84578031-84578053 ATGGCTGCTTTCTTCCTACAAGG + Intronic
933947823 2:87302126-87302148 GTTGCTGCTTTTGTTGTCCAAGG - Intergenic
934087909 2:88525579-88525601 GTGGCTACTTTCCTTGTCTGTGG + Intronic
935513801 2:104008491-104008513 CAGGCTGCTGACTTTGTCCATGG + Intergenic
936236357 2:110745884-110745906 GTGGCTGCTTTCCCTGACTATGG - Intronic
936264937 2:110996859-110996881 TTGGCTGCTTTCTGCTTCCAGGG - Intronic
936332375 2:111559446-111559468 GTTGCTGCTTTTGTTGCCCAAGG + Intergenic
936898059 2:117451236-117451258 GAAGCATCTTTCTTTGTCCAAGG + Intergenic
936899341 2:117466402-117466424 GTGTCTGCTTGCTTTCTCAATGG - Intergenic
937014923 2:118596556-118596578 TTGTCAGCTTTCTTTTTCCAGGG + Intergenic
937691047 2:124755609-124755631 GGGGCTGCTTCCGTGGTCCATGG + Intronic
938071457 2:128310568-128310590 GGGGCTGTTTTCCTTGACCATGG - Intronic
938904616 2:135826163-135826185 ATGGCTGCTAAGTTTGTCCAGGG + Intronic
940159465 2:150695894-150695916 GTGGATGCTTTCTGTGTTTATGG + Intergenic
940637354 2:156315091-156315113 GGGGCAACTTTCTTTGTCCAGGG - Intergenic
941799462 2:169641130-169641152 GTGGCCGCTCTCTTTGTGGAAGG + Exonic
944978735 2:205089560-205089582 CTGGCTCCTTTCACTGTCCATGG + Intronic
1169587208 20:7098289-7098311 TAGGATCCTTTCTTTGTCCATGG - Intergenic
1170835652 20:19882583-19882605 GTGTGTGGCTTCTTTGTCCATGG + Intergenic
1171254475 20:23679021-23679043 CTGGGTGCTTTCATTGTCAAAGG + Intergenic
1172487510 20:35307227-35307249 GTGCCTTCTTGCTTGGTCCAAGG + Intronic
1172767774 20:37359825-37359847 GTGGCTGCTGCCTTAGTCTAGGG + Intronic
1173313697 20:41924233-41924255 GTGAGTGCTTTCTGTGTGCAGGG + Intergenic
1173903513 20:46608348-46608370 GTGGCTGCTTTCTCACTGCAAGG + Intronic
1174545097 20:51319169-51319191 GTCACTTCCTTCTTTGTCCATGG - Intergenic
1174795484 20:53518978-53519000 GTGGCTGCTTTCCTGGTGCAAGG - Intergenic
1174798527 20:53542775-53542797 GTGGCTGCTTTCCTGCTGCAAGG - Intergenic
1174868023 20:54156754-54156776 GTGGCTGCTTTCATGTTCCAAGG + Intronic
1174919074 20:54682811-54682833 GTGGCACCGTTCTTTGTCCCAGG + Intergenic
1175078261 20:56394020-56394042 GTGGCTGAGTTACTTGTCCAAGG - Intronic
1175356443 20:58372668-58372690 GTGCCTGCTTTTTTTTGCCATGG + Intergenic
1176874554 21:14115403-14115425 GTGGCTGCTTTCTTTGTCCGGGG + Intronic
1176875686 21:14124680-14124702 GTGGCTGCTTTCTTTGTCCGGGG + Intronic
1178209551 21:30513652-30513674 GGGACTGCTTTCCTTTTCCATGG - Intergenic
1181349746 22:22246453-22246475 GTGGCTGCTTTCTTGCTACTAGG - Intergenic
1181463453 22:23098478-23098500 GTGGCTGCTGTCCCTGCCCATGG - Intronic
1183578556 22:38708155-38708177 GTGGTTAAATTCTTTGTCCAAGG + Intronic
1185004316 22:48266605-48266627 GGGGATACTTTCTGTGTCCAGGG - Intergenic
950447642 3:13047495-13047517 GAGGCTGCTTCCGGTGTCCAGGG + Intronic
952206563 3:31186223-31186245 GTGGCTGGATTCTCTGCCCAGGG - Intergenic
952827464 3:37536273-37536295 GTGGATGATGACTTTGTCCATGG + Intronic
953500286 3:43426507-43426529 GAGGCTGTTTTCTTTCTCAAAGG + Intronic
954932551 3:54296701-54296723 CTGGCTGTTTTCTTTGTACACGG + Intronic
955544819 3:60017244-60017266 TCGTCTGCTTTCTTTTTCCAAGG - Intronic
959595467 3:108124511-108124533 TCTGCTGCTTTCTTTGTCCATGG + Intergenic
960703048 3:120455771-120455793 GTGGGTGCTTTCATCTTCCAGGG + Intergenic
960918291 3:122719851-122719873 GTTGCTGTTTTGTTTGTGCATGG - Intronic
961009661 3:123427174-123427196 CTGGCTGCTGCCCTTGTCCAGGG - Intronic
962881709 3:139583961-139583983 GTGACTTCTTTCTTTTTCCTTGG + Intronic
966497728 3:180600161-180600183 GGAGCTGCTTTCTATGTTCACGG + Intergenic
966876043 3:184322275-184322297 TTGGCTGCTTTCTATTTCCCAGG + Intronic
967136041 3:186513446-186513468 GTGGCAGCTTTATCTCTCCATGG - Intergenic
967324318 3:188224134-188224156 GTGACTGCTTGCTTTGACAAAGG - Intronic
970486529 4:16530249-16530271 GTGGCTGCTCTCCTTGTTCAAGG + Intronic
971208107 4:24589721-24589743 ATGGCAGCTTTCTTTAGCCATGG - Intergenic
971722770 4:30268032-30268054 GTGTTTGCTTTTTTTGTCCTTGG - Intergenic
974109533 4:57510859-57510881 TTGGCTGCTTTGTTGGTCCAAGG + Intergenic
974666404 4:64968592-64968614 ATGCCTGCTTCCTTTCTCCATGG - Intergenic
974985934 4:69026231-69026253 TTTGCTCCTTTGTTTGTCCAAGG + Intronic
976657365 4:87503311-87503333 ATGGCTTCCTTCTTTGTCTATGG + Intronic
977738558 4:100447840-100447862 ATGGCTGCTTTCTCTGTGTAAGG - Intronic
981401446 4:144318601-144318623 TTGGCTTATTTCTTTGTCCTGGG + Intergenic
981987191 4:150872056-150872078 GTGGCTGCTTTCATGATACAAGG - Intronic
984936591 4:184895244-184895266 GTGGCTGCCTTCCTAGACCATGG + Intergenic
986111692 5:4725314-4725336 GTGGCTTCTGTTTCTGTCCAGGG - Intergenic
986993528 5:13580114-13580136 GTGGCTTCCTTCTTTCTCCCGGG + Intergenic
987101133 5:14592009-14592031 GTGGCTGCTTTCCCTGTGTAAGG + Intronic
991271071 5:64781953-64781975 GTGCCTGGTTTCATAGTCCAAGG + Exonic
991972874 5:72157820-72157842 GTAACTGCTTTCTATGTGCAAGG - Intronic
992441263 5:76799574-76799596 GTGCCTGATTTATTGGTCCAAGG - Intergenic
993513845 5:88804801-88804823 TTGGCTGCTTTCTTTTTTCTAGG - Exonic
994363100 5:98878240-98878262 GTGACTGCTCACTTTCTCCAAGG - Intronic
995877840 5:116809665-116809687 TAGGCTGGTTTCTCTGTCCATGG - Intergenic
996647599 5:125835179-125835201 TTGGGTGTTTTCTTTGTTCAAGG + Intergenic
1001022803 5:168197882-168197904 GTGGCTGATTTCTTTGCCAATGG - Intronic
1001539589 5:172528088-172528110 GAGGCTGCTTGGTTTGTCCCTGG + Intergenic
1003412856 6:5880847-5880869 GTGGCTGCTTTCTTCTAGCAAGG + Intergenic
1004035279 6:11917416-11917438 GTGGCTTCTTTCTCTTTACATGG - Intergenic
1004447208 6:15711333-15711355 GGAGCTGCTTTCTGTGCCCAAGG + Intergenic
1004475309 6:15966087-15966109 GTGCCTGCTTTCTAATTCCATGG - Intergenic
1004509189 6:16270792-16270814 GTGGCTGCTGAATCTGTCCATGG - Intronic
1004966059 6:20853023-20853045 GTGGCTGCTTTCATGCTACAAGG - Intronic
1006577316 6:35056065-35056087 GTTTCTGCTTTCTGTGTCCAAGG + Intronic
1006928235 6:37671104-37671126 GAGGCTGTTTTCCTTTTCCATGG - Intronic
1006941148 6:37753202-37753224 GTGGATGCTTCCCTTGACCAAGG + Intergenic
1007288988 6:40770044-40770066 GCTCCTGCTGTCTTTGTCCATGG + Intergenic
1007603263 6:43097082-43097104 GTGTGTGTTTTCTTTGGCCAGGG - Intronic
1007734600 6:43972698-43972720 CAGGCTGCTTTCTTTCCCCAAGG - Intergenic
1011974221 6:93273871-93273893 GAGGCTGCTTCCTTAGGCCATGG + Intronic
1012763025 6:103327045-103327067 GTGGCTGCTCTCTTAGGCAAAGG - Intergenic
1013118618 6:107122083-107122105 ATGGCAGCTTGCTCTGTCCATGG + Intergenic
1013211551 6:107991447-107991469 GTGGCTGCTTTCTTTGTCCGGGG + Intergenic
1014972601 6:127836041-127836063 TTTGCTGTTTTCTTTGTTCAAGG - Intronic
1016028105 6:139309534-139309556 TTGACTACTTTCTTTGTACAAGG - Intergenic
1016216874 6:141615148-141615170 ATTGCTGCTTTCTTTTTTCAGGG + Intergenic
1017823261 6:158064048-158064070 GAGGCTGCTTTCTCTGTCGTAGG + Intronic
1018855365 6:167670589-167670611 GTGGATGCCTCCTGTGTCCAGGG - Intergenic
1018873741 6:167802630-167802652 GTGGAGTCTCTCTTTGTCCAGGG + Intergenic
1019661376 7:2225862-2225884 GTGGCTGCATTCTCTGACCAGGG + Intronic
1019954187 7:4399913-4399935 GTGGGTGCTTTCTCTGGTCACGG - Intergenic
1020671171 7:11114828-11114850 GTGGCTGCTGTCTTAATCAATGG - Intronic
1022949806 7:35327009-35327031 GTGGATGCTTTTTTTGACAACGG - Intergenic
1023718869 7:43072573-43072595 GTGGCTGTTTTCTTTGTCCGGGG - Intergenic
1023891229 7:44393253-44393275 GGTGCTGCTTCCTTTGACCAAGG - Intronic
1028363977 7:90005528-90005550 GTGGCAGCTTTGGTTGTCTAGGG - Intergenic
1028465098 7:91142292-91142314 GTGGCTGCCTTCTTTAGCAAAGG + Intronic
1028660312 7:93264765-93264787 GTGCCTGCTTTCTTCCTCTAAGG + Intronic
1030259134 7:107544055-107544077 GTGGGTGCTTGCTTTGTGCCTGG - Intronic
1030954027 7:115828427-115828449 TTGGCTCCATTCTTTGTCAATGG - Intergenic
1033815600 7:145068901-145068923 GTGCATGATTTCTTTGTCCGAGG - Intergenic
1034542133 7:151764995-151765017 CTGGCTGCTGTCTATGGCCAGGG + Intronic
1034816396 7:154175538-154175560 GTGGCTGTATTTTCTGTCCAGGG - Intronic
1035029432 7:155847976-155847998 GTGGCCGCATTCTTCGCCCATGG + Intergenic
1036929998 8:12946930-12946952 GTAGCTGCTGCCTTTATCCAAGG - Intronic
1037581679 8:20249296-20249318 ATGGCTTCTTTCTATTTCCAAGG + Exonic
1039510993 8:38091672-38091694 GTGGCTGCTTTCTTTGTCCGAGG - Intergenic
1041157801 8:55005854-55005876 GTGGCTGTCTTCTTTCTCTAGGG + Intergenic
1044770985 8:95633774-95633796 GTGGCTGCTTTCTCTTACCAGGG - Intergenic
1045223635 8:100222897-100222919 GTGGCTGCTTACTGGGTACAGGG - Intronic
1045280913 8:100749069-100749091 GTTGGTGCTTTCTTTGTGCTGGG + Intergenic
1045696373 8:104813106-104813128 GTGGCTGCCTGCTTTGTCTGTGG + Intronic
1048621842 8:136142151-136142173 CTGGCTGCCTGCTTTTTCCAGGG + Intergenic
1051384055 9:16487788-16487810 ATGGCTGCTTTCCTTGTTAAGGG - Intronic
1056254676 9:84786912-84786934 ATGGCTTCTTTCTTGGTTCAAGG - Intronic
1056779899 9:89541554-89541576 GTGGCTGCTGCCTTTGCCCCTGG + Intergenic
1059442014 9:114313243-114313265 CAGCCTGCTTTCTGTGTCCACGG + Intergenic
1060675459 9:125510433-125510455 CTGGCTGCCTTCTGAGTCCATGG + Intronic
1060719992 9:125970308-125970330 GGGGGTGCTATCTGTGTCCACGG + Intergenic
1061296222 9:129678283-129678305 GGGGCTGGTTTCTCTGTCAAGGG + Intronic
1185859204 X:3561989-3562011 GTGGCTGCTTGGTGGGTCCAAGG - Intergenic
1187392431 X:18894854-18894876 TTGGCTCCTTTCTTTCACCAGGG + Intronic
1187438841 X:19298551-19298573 GTGGTTGCCTTCTTTGTGCTTGG + Intergenic
1188443593 X:30234640-30234662 GGGGCTACTTTCTTAGACCAAGG - Intronic
1196015314 X:110933766-110933788 GTCCCTGCATTCTTTGTTCAAGG + Intergenic
1197893939 X:131291012-131291034 ATGGCTGCTTGCTGTGTCCTAGG - Intronic
1198664690 X:139007858-139007880 GTGTCTGCTTGCTTTCTCAATGG + Intronic
1200138732 X:153886883-153886905 GTGTCTTATTTCTTTGTCCTCGG + Intronic