ID: 1123223430

View in Genome Browser
Species Human (GRCh38)
Location 14:106877895-106877917
Sequence GTCCAGGGCTCAGACTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 4, 1: 7, 2: 7, 3: 17, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123223424_1123223430 14 Left 1123223424 14:106877858-106877880 CCAGCCACTGACTGTGTAAAAGG No data
Right 1123223430 14:106877895-106877917 GTCCAGGGCTCAGACTTTCCTGG 0: 4
1: 7
2: 7
3: 17
4: 186
1123223427_1123223430 10 Left 1123223427 14:106877862-106877884 CCACTGACTGTGTAAAAGGTGGC No data
Right 1123223430 14:106877895-106877917 GTCCAGGGCTCAGACTTTCCTGG 0: 4
1: 7
2: 7
3: 17
4: 186
1123223423_1123223430 15 Left 1123223423 14:106877857-106877879 CCCAGCCACTGACTGTGTAAAAG No data
Right 1123223430 14:106877895-106877917 GTCCAGGGCTCAGACTTTCCTGG 0: 4
1: 7
2: 7
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123223430 Original CRISPR GTCCAGGGCTCAGACTTTCC TGG Intergenic
900717197 1:4152788-4152810 GCACTGGGCTCAGGCTTTCCTGG - Intergenic
901294931 1:8153981-8154003 GTCAGGGGATCAGAATTTCCTGG - Intergenic
901898395 1:12335556-12335578 CTCCAGGGCATAGACTTTCTCGG + Intronic
901974257 1:12931934-12931956 GTCCAGGGCTGAGGATTTTCAGG - Intronic
902010918 1:13269834-13269856 GTCCAGGGCTGAGGATTTTCAGG + Intergenic
903174157 1:21570660-21570682 AGCCAGGGCTCAAACTTGCCTGG - Intronic
903837037 1:26211151-26211173 GTCCAGAGATGAAACTTTCCTGG + Intergenic
905627498 1:39498477-39498499 GTCCAGGCCTCAGACAGTTCTGG - Intronic
905668925 1:39778631-39778653 GTCCAGGCCTCAGACAGTTCTGG + Intronic
906787476 1:48628676-48628698 TTCCATTGCTCAGATTTTCCTGG + Intronic
907739016 1:57145530-57145552 GTCCAGTGATTTGACTTTCCGGG - Intronic
907936569 1:59047135-59047157 GCCCAGGGCTCACAGTTCCCTGG + Intergenic
915540320 1:156561948-156561970 CTTCAGGGCTCTGTCTTTCCAGG + Exonic
915575478 1:156773538-156773560 ATCCAGGGCTGAGAGTGTCCCGG - Intronic
917303505 1:173603673-173603695 GTCCAGGGCTCAGACTTTCCTGG + Intergenic
918485012 1:185019412-185019434 CTCCAGGGCTCAGTTTTTTCTGG + Intergenic
919073274 1:192783112-192783134 GTCTATTGCTGAGACTTTCCAGG + Intergenic
920920404 1:210293220-210293242 GCCCAGGGTTCAGATTTTCCTGG + Intergenic
922345653 1:224694168-224694190 GTCCAGGGCTCAGCTCATCCTGG - Intronic
922856656 1:228780864-228780886 GTCCATAGCTCAGAATGTCCTGG + Intergenic
924439859 1:244077178-244077200 TCCCAGGGGTCAGACTTCCCTGG + Intergenic
1063556951 10:7089433-7089455 TTTCATGGCTCAGACTTTCTTGG - Intergenic
1063939396 10:11111158-11111180 CTCAGGGGCTCAGACTTTCTGGG + Intronic
1066688501 10:38003515-38003537 GTCCAGGGTTCAGACTTTCCTGG - Intergenic
1067004128 10:42645465-42645487 CTCCAGGGCTCAGACTTTCCTGG + Intergenic
1067806779 10:49398116-49398138 GTCCAGGGTTCTGACCTGCCGGG - Intergenic
1070175652 10:73967164-73967186 TTCCAGAGCTCAGCCCTTCCTGG - Intergenic
1072227501 10:93384000-93384022 TTTTAGGGCTCAGACTCTCCAGG - Intronic
1072976917 10:100066846-100066868 GACCAGGGCTCAGACCCTCTGGG + Intronic
1073379193 10:103065192-103065214 GGCCAGGGCACACAGTTTCCAGG + Intronic
1074855496 10:117470176-117470198 GGGCAGGGCTTTGACTTTCCTGG + Intergenic
1075309888 10:121405233-121405255 TTCCAGGGCTGAGGCTTGCCTGG + Intergenic
1075554377 10:123419710-123419732 GTCCAGGTCTCAGGCTTCTCTGG + Intergenic
1076108716 10:127845261-127845283 GTGCAGGGCTCAGCCTGGCCTGG + Intergenic
1076193508 10:128499129-128499151 GCCCAGGGCCCAGCCTCTCCAGG - Intergenic
1076356757 10:129858755-129858777 GTCCAGGCCTCAGAGGCTCCAGG + Intronic
1076783365 10:132736701-132736723 GCCCAGACCTCAGACATTCCTGG + Intronic
1076999315 11:314790-314812 CACCCGGGCTCAGACTCTCCAGG - Intronic
1077000553 11:320110-320132 CACCCGGGCTCAGACTCTCCAGG + Intronic
1077097236 11:804289-804311 GTCCAGGGCGCTGCCTTTCCTGG - Exonic
1077423367 11:2463170-2463192 GTCCCTGGCTCAGCCTCTCCCGG + Intronic
1077724312 11:4658844-4658866 GTCCAGGACTCATACTTTCCTGG - Intergenic
1078007511 11:7543518-7543540 GTCCAAGGCTCAGAATATCCTGG + Intronic
1079089515 11:17470891-17470913 TTCCAGGCCTCAGTCTTCCCTGG + Intronic
1080938198 11:36884689-36884711 GACCAGGGCTCGCACTTTACTGG + Intergenic
1082608219 11:55268142-55268164 CTTCAAGACTCAGACTTTCCCGG + Intronic
1084530052 11:69721877-69721899 GTCCAGGGCTGGGTGTTTCCGGG - Intergenic
1085038408 11:73313057-73313079 GTCCAGGGTTTATAATTTCCAGG - Intronic
1085261028 11:75204840-75204862 GTCCTGGGGCCAGGCTTTCCTGG + Exonic
1085791957 11:79504070-79504092 ACCCAGGGCTCTGACCTTCCAGG + Intergenic
1086384190 11:86290144-86290166 GCCCAGGGTCCACACTTTCCAGG + Intergenic
1088900256 11:114110207-114110229 ATGAAGGGCTCAGACTTTCTTGG + Intronic
1089130724 11:116209863-116209885 ATCCAGGACTCTGACTTTGCTGG + Intergenic
1089395633 11:118135151-118135173 GGCTGGGGCTCAGATTTTCCTGG - Exonic
1089495799 11:118908205-118908227 GTCCAAGGCTCAGATGTTCTGGG - Intronic
1090334090 11:125951177-125951199 CCCCAGGGCTCTGACATTCCAGG + Intergenic
1090403192 11:126461904-126461926 GTCCTGGGCTCTGAATTTCAAGG - Intronic
1090711173 11:129387047-129387069 TACCAGGGTTCAGACTTTCGCGG + Intronic
1092318371 12:7443585-7443607 ATCAAGGGCTCAGACTTAGCTGG + Intronic
1092898919 12:13040396-13040418 TTCCTGGGCTCATACCTTCCTGG + Intergenic
1093895003 12:24564463-24564485 GTCAAGGGCGGAAACTTTCCCGG + Intergenic
1094301402 12:28968470-28968492 TTCCAGGGCACAGAATTTCAGGG - Intergenic
1094368925 12:29714778-29714800 GTCCCTGGCTCAGACTCCCCAGG + Intronic
1112257103 13:97844162-97844184 GTCCAGGGTTAAGATTTTCTGGG - Intergenic
1113012684 13:105788367-105788389 GGCCAGGGCTCAGACATTTGAGG - Intergenic
1114680255 14:24478279-24478301 GTCCAGGGTTGACGCTTTCCTGG - Intergenic
1118617036 14:67580986-67581008 GTCCCACCCTCAGACTTTCCGGG - Exonic
1118747668 14:68785755-68785777 GTTCTGGGCTCACACTTCCCTGG + Intergenic
1118974447 14:70664884-70664906 GACCAGGGTTCAGACTTTGGGGG - Intronic
1119584760 14:75822892-75822914 GGCCAGGCCTCAGACTGTCTGGG - Intronic
1120031088 14:79641672-79641694 ATCCAGGGCTTAGTCTTTCATGG + Intronic
1120228207 14:81814533-81814555 GTCCTGTGCTAAGTCTTTCCTGG - Intergenic
1120584021 14:86288256-86288278 ATCCAGTGCTCAGATTTTCATGG + Intergenic
1120824994 14:88946737-88946759 GGCCAGGGCTCAGTCTTCCCAGG + Intergenic
1121300053 14:92862912-92862934 GACCTGGGCTCTGACTGTCCTGG + Intergenic
1121573145 14:94962394-94962416 CACCAGAGCTCAGAATTTCCAGG - Intergenic
1122374185 14:101247592-101247614 CTCCAGGCCTCAGCCTGTCCTGG + Intergenic
1122862500 14:104588842-104588864 GGCCAGGGCTCAGGCTGTCTCGG - Exonic
1122871813 14:104642236-104642258 GTCCTGTGCTGAGACTTTCTGGG - Intergenic
1123223430 14:106877895-106877917 GTCCAGGGCTCAGACTTTCCTGG + Intergenic
1125556566 15:40590695-40590717 GTCTGGGGCTCAGACTTTCCTGG - Intergenic
1127538137 15:59910196-59910218 GTTAAGGGCTCAGACTGTCAAGG + Intergenic
1128131934 15:65234317-65234339 GTCCTGAGCTGAGAGTTTCCGGG + Intergenic
1128599582 15:68984540-68984562 GTCCAGGGCTCAGACTTTCCTGG + Intronic
1129299927 15:74619662-74619684 GCCCAGGGAGCAAACTTTCCAGG - Intronic
1130070075 15:80639759-80639781 GTACAGGACACAGACTTTCAAGG - Intergenic
1130153588 15:81331145-81331167 ATCCAGGGCTCAGACTTTCCTGG - Intergenic
1130903499 15:88224310-88224332 CTCCAGGCCTCAGACTCTGCAGG - Intronic
1131527265 15:93162429-93162451 GTCCGGGGCTCAGACTTTCCTGG - Intergenic
1131534282 15:93221653-93221675 GTCCGGGGCTCAGACTTTCCTGG - Intergenic
1131549518 15:93344993-93345015 GTCCGGGGCTCAGACTTTCCTGG + Intergenic
1132343170 15:101090775-101090797 GTGGAGGCCTCAGACTTTACAGG + Intergenic
1136608941 16:31354832-31354854 CTCCTTGGCCCAGACTTTCCAGG + Intergenic
1137412128 16:48237735-48237757 GTCCCAAGCTCAGACATTCCAGG + Intronic
1137535013 16:49314036-49314058 GTCCAAGGCTCACACGCTCCTGG - Intergenic
1139491582 16:67288795-67288817 GTCCCGGGCTCAGACCTGCAGGG - Exonic
1139593989 16:67947772-67947794 GTCCAGGGCGCTGTCCTTCCTGG - Exonic
1141204934 16:81926216-81926238 GTCCTGGGGTCAGACTGTGCTGG + Intronic
1142805227 17:2367903-2367925 CCCCAGGGCTCAGTCTTCCCAGG + Intronic
1146318197 17:31825811-31825833 GTCCCAGGCTCAGAGTTTCTGGG - Intergenic
1147635860 17:41963558-41963580 GTTCTGGGGTCAGACTGTCCTGG + Intronic
1147744696 17:42688033-42688055 GTCCAGGCCTACAACTTTCCTGG - Intronic
1148216001 17:45834312-45834334 GCCCAGGGCTCAGCCCTTCCTGG - Intronic
1150324967 17:64249622-64249644 GTGCAGGGCCCAGAATTTTCTGG - Intronic
1151913306 17:77098825-77098847 GTCCAGGGCTCCCACTCTCAAGG - Intronic
1152772787 17:82180350-82180372 GGGCAGGGCTCAGCCATTCCCGG - Intronic
1152892586 17:82890955-82890977 CTCCTGGGCTCTCACTTTCCAGG - Intronic
1153485388 18:5592814-5592836 GTCTAGAGATCTGACTTTCCAGG - Intronic
1153572854 18:6490832-6490854 GTCCAGGGAGCAGACCTTCCTGG + Intergenic
1158955696 18:62535669-62535691 GCCCAGGGCTGAGGCTTCCCAGG + Intronic
1160028273 18:75236904-75236926 GTCAAGGAGTCAGACCTTCCTGG - Intronic
1161408628 19:4103847-4103869 GGCCAGGGCTCAGACAGCCCAGG + Intronic
1162249488 19:9430309-9430331 GTCCAGGGCTCAGACTTTCCTGG + Intronic
1163794747 19:19330952-19330974 GTCCAGGGCTGAGTGTTTCAAGG - Intronic
1166722648 19:45005900-45005922 GGCCAAGGCTGAGACTTTTCTGG + Intronic
1166912287 19:46167582-46167604 GACCAGGGCTCACACTTTACTGG + Intergenic
1167207251 19:48110860-48110882 GTGGAGGGCTGGGACTTTCCAGG + Intergenic
1168104210 19:54156718-54156740 GACCAGGGCCCAGACCTTCAGGG - Intronic
1168439972 19:56356245-56356267 GTTCGGGGCTCAGACTTTCCTGG - Intronic
927215360 2:20665550-20665572 GTCCAGGGGTCCGCCCTTCCCGG + Intergenic
928920953 2:36526742-36526764 GTCCAGGGGTCAGTCATTCCTGG + Intronic
930021390 2:47004108-47004130 CTCCAGAGCTCAGCCTTGCCGGG + Intronic
930602302 2:53456644-53456666 GACCAGTGCTCACACTTTGCTGG - Intergenic
930610405 2:53536648-53536670 GTCCAGAGGACAGACTTTCCAGG - Intronic
930773087 2:55147331-55147353 ATTCAGGGCACTGACTTTCCCGG - Intergenic
932407398 2:71522625-71522647 GTCCAGAGCTCAGAAGATCCAGG - Intronic
935227124 2:101062207-101062229 GCCCAGGGCTCTGCTTTTCCTGG + Intronic
935577054 2:104722161-104722183 GTCCAGGGCTTCGCCTTCCCAGG - Intergenic
936592615 2:113818521-113818543 GTCAAGGACTCAGGCTCTCCCGG + Intergenic
936810147 2:116388866-116388888 GAGCAGAGCTCAGGCTTTCCAGG + Intergenic
943102573 2:183506193-183506215 TTCCAGGGCTCAGAAGTTCTAGG - Intergenic
946249536 2:218404236-218404258 GTCCTGGGTGCAGAATTTCCAGG - Intronic
946283041 2:218680197-218680219 ATCCAGGACTCAGACTCTCGAGG - Intronic
947911181 2:233802030-233802052 GTTCAGGGCTGAGACTGTCAGGG + Intronic
1173132514 20:40408093-40408115 GCCCAGGGCTCAGCATTCCCAGG - Intergenic
1173998341 20:47357029-47357051 CTCCGGGCCTCAGGCTTTCCTGG - Intergenic
1175580266 20:60093459-60093481 GTCCAGGTCTCAGGCTGTGCTGG + Intergenic
1175619633 20:60432664-60432686 GTCTAAGGCTCAGACTCTCAGGG + Intergenic
1175980678 20:62737124-62737146 GGCCTGGGCCCAGTCTTTCCCGG + Intronic
1176675370 21:9772352-9772374 GTCCATGTCCCAAACTTTCCTGG - Intergenic
1176874555 21:14115418-14115440 GTCCGGGGCTCAGACTTTTCTGG + Intronic
1176875687 21:14124695-14124717 GTCCGGGGCTCAGACTTTTCTGG + Intronic
1178408206 21:32342673-32342695 GACCAGGGTTCCGGCTTTCCTGG - Intronic
1179189573 21:39111991-39112013 ATCCACATCTCAGACTTTCCGGG + Intergenic
1179543970 21:42101955-42101977 GTCCAGGGCAGAGACATCCCAGG - Intronic
1180184680 21:46133618-46133640 GACCAGGGCTCAGCCTATTCCGG + Intergenic
1180184698 21:46133712-46133734 GACCAGGGCTCAGCCTATTCCGG + Intergenic
1180184708 21:46133759-46133781 GACCAGGGCTCAGCCTATTCCGG + Intergenic
1180184718 21:46133806-46133828 GACCAGGGCTCAGCCTATTCCGG + Intergenic
1181030446 22:20146902-20146924 GTTCAGGGCTGAGACATTCTGGG + Intronic
1182429245 22:30290378-30290400 GCCCAGTGCTCAGACTTTGGTGG + Intronic
1182485136 22:30634971-30634993 GCCCAGGGCTCTGTCTTGCCGGG + Intergenic
1183486180 22:38088867-38088889 GACCAGGGCGCGGACTCTCCTGG + Exonic
1183658122 22:39202521-39202543 CTCCTAGGCTCAGACGTTCCTGG + Intergenic
1184913194 22:47549723-47549745 GCCCAAGGGCCAGACTTTCCTGG + Intergenic
1185161504 22:49232735-49232757 CTCCAGGGCTCAGCCGCTCCGGG + Intergenic
949942103 3:9163148-9163170 GCCCAGGCCTCAGTCTGTCCAGG + Intronic
952377985 3:32782754-32782776 GCCCAGGCCTGAGACTTTCCTGG - Intergenic
954520232 3:51218555-51218577 CTACAGGGTACAGACTTTCCAGG - Intronic
955409592 3:58647138-58647160 GTCCAGGGCTCCCCCTCTCCTGG + Intronic
958641911 3:96815098-96815120 GTACAGGGGTCAGAGTCTCCTGG + Intronic
960257459 3:115526217-115526239 GTCCTGATCTCAGATTTTCCAGG + Intergenic
961048561 3:123726650-123726672 GTCAAGGGCTCAGAGCTGCCGGG + Intronic
966613373 3:181890013-181890035 CTCCAGGCCTCAGCCTTTCCTGG - Intergenic
968739046 4:2318112-2318134 GTCCAGGGCCCAGGCTTCCCAGG - Intronic
969946503 4:10788691-10788713 GTGAAGGGCTCAGTGTTTCCCGG + Intergenic
971292185 4:25353791-25353813 GGACAGGGCTAAGCCTTTCCAGG - Intronic
973572798 4:52257606-52257628 GTCCAGGGGTCAGAGGTTCTGGG - Intergenic
976523464 4:86058298-86058320 GTCCAGGGCTGGCACTTACCAGG - Intronic
976754708 4:88485442-88485464 GTCCAGGCCTCAAATATTCCAGG - Intronic
978858221 4:113417740-113417762 TTCCATTGCTGAGACTTTCCAGG + Intergenic
979795949 4:124846930-124846952 ATACAGGGCTCAGACTTCTCAGG - Intergenic
992795991 5:80255719-80255741 GCCCAGGGCACAGGATTTCCCGG + Intronic
993699240 5:91098685-91098707 GTCCATGGCTTATATTTTCCTGG - Intronic
999740484 5:154546207-154546229 GTGCAGGATTCAGACTTGCCTGG + Intergenic
999782929 5:154865186-154865208 TTCCAGGACACAGAATTTCCAGG + Exonic
1000342728 5:160289853-160289875 GTGCTGGGCTCAGACGTGCCCGG + Intronic
1001948812 5:175801694-175801716 GTGCAGCACTCAGACATTCCTGG + Intronic
1002304408 5:178274729-178274751 GGCCAGGGCTCAGCCTTGCAGGG + Intronic
1002400651 5:178990059-178990081 AGCCAGGGCTCAGCCTTTCCAGG + Intronic
1003493779 6:6646277-6646299 GTCCAGGGGTCAGACTATCTGGG - Intronic
1004462593 6:15852261-15852283 GTCCAGGACTGAGAGTTTCCTGG - Intergenic
1005422579 6:25668107-25668129 GTCCTGAGCTCAGACTCTGCAGG - Intronic
1010970756 6:82260542-82260564 TTCCAGGGCTCAACTTTTCCTGG + Intergenic
1013024002 6:106251321-106251343 GGCTAGGGCTCAGACTTCACTGG - Intronic
1013211552 6:107991462-107991484 GTCCGGGGCTCAGACTTTACTGG + Intergenic
1022517351 7:30984372-30984394 GTGCCGGGCTCAGACTCTCTGGG + Intronic
1023718868 7:43072558-43072580 GTCCGGGGCTCAGACTTTCCTGG - Intergenic
1026438655 7:70423081-70423103 TTCCAGGGCTCTGACTTCACTGG - Intronic
1030779536 7:113582644-113582666 GTCCATGGCTGAGTCTCTCCTGG + Intergenic
1033362815 7:140650025-140650047 GTCCTGGGCTCAGACTGCCTGGG - Intronic
1033445930 7:141422199-141422221 GGCCAAGGCTCTGACTTGCCTGG + Intronic
1036510740 8:9397827-9397849 GTCCAGACCTCAAACTTCCCTGG + Intergenic
1037324297 8:17673211-17673233 GCCCAGCTCTCAGACTTTGCAGG - Intronic
1039397201 8:37236617-37236639 GCACAGGGCTCAGTCTGTCCAGG + Intergenic
1039509796 8:38081906-38081928 TGCCGAGGCTCAGACTTTCCTGG - Intergenic
1039510992 8:38091657-38091679 GTCCGAGGCTCAGACTTTCCTGG - Intergenic
1042072256 8:64949135-64949157 TTCCAGGTTTCAGACTTTCATGG - Intergenic
1042964504 8:74336200-74336222 GAACAGGGCTCAGGTTTTCCAGG - Intronic
1048520262 8:135147360-135147382 GTCCTGGGCTCAGCCATCCCAGG - Intergenic
1049049350 8:140181989-140182011 GTCTGGGGACCAGACTTTCCTGG + Intronic
1049092711 8:140528774-140528796 GTCCTAAGCTCAGATTTTCCTGG - Intergenic
1049284103 8:141765272-141765294 GAGCAGGGCTCAGTCTTCCCAGG + Intergenic
1049529615 8:143147836-143147858 GGCCAGGTCCCAGACTTCCCTGG - Intergenic
1050638425 9:7639044-7639066 GTCCAAGGTTGTGACTTTCCTGG + Intergenic
1050697376 9:8294126-8294148 TTGGAGGGCTCAGACTTTCATGG + Intergenic
1055795370 9:79969742-79969764 GTCCAGTTCTCAGCCTCTCCAGG - Intergenic
1056460695 9:86807149-86807171 GTTCAAGGCTCACACTGTCCAGG + Intergenic
1058135699 9:101305504-101305526 CCCAAGGTCTCAGACTTTCCGGG + Intronic
1058662933 9:107283111-107283133 GTCCAGGCCGCCGACATTCCAGG + Intergenic
1059428884 9:114238103-114238125 GTTCAGGGCTCAGAGCTTCCGGG + Intronic
1060553169 9:124495220-124495242 GCCCAGGCCTCAGTCTCTCCGGG - Intronic
1061087176 9:128405924-128405946 TTCCCGGGCACAGATTTTCCTGG - Intergenic
1061385204 9:130285527-130285549 GGCCAGGGCTCACACTTCCCTGG + Intronic
1061777340 9:132974199-132974221 GCTCAGGGCTTAGACTCTCCAGG - Intronic
1189373687 X:40449615-40449637 GTCCAGGGCTCAGAGAGTGCTGG + Intergenic
1193397657 X:81004091-81004113 GCAGAGGGCTCAGACTGTCCCGG + Intergenic
1193552921 X:82921170-82921192 CTCAAGGGTTCATACTTTCCTGG + Intergenic
1195510747 X:105712930-105712952 GGCCAGGTTTCAGACTTGCCTGG - Intronic
1200031654 X:153301932-153301954 GTCGGAGGCTCAGACTCTCCAGG + Intergenic
1200179699 X:154142984-154143006 GTCCTGGCCACAGACTTGCCAGG - Intergenic