ID: 1123223451

View in Genome Browser
Species Human (GRCh38)
Location 14:106878032-106878054
Sequence CTGAGCACACAGAAGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123223440_1123223451 23 Left 1123223440 14:106877986-106878008 CCCATCTTTGATCGTCCTGCAAC No data
Right 1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG No data
1123223441_1123223451 22 Left 1123223441 14:106877987-106878009 CCATCTTTGATCGTCCTGCAACA No data
Right 1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG No data
1123223444_1123223451 8 Left 1123223444 14:106878001-106878023 CCTGCAACAAAAGCACTAGGGAG No data
Right 1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123223451 Original CRISPR CTGAGCACACAGAAGGCAGC AGG Intergenic
No off target data available for this crispr