ID: 1123386873

View in Genome Browser
Species Human (GRCh38)
Location 15:19820387-19820409
Sequence GTGGACAATTGGAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123386873_1123386877 28 Left 1123386873 15:19820387-19820409 CCCAAAGTGCTCCAATTGTCCAC No data
Right 1123386877 15:19820438-19820460 AAACTGCTCAATCAAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123386873 Original CRISPR GTGGACAATTGGAGCACTTT GGG (reversed) Intergenic
No off target data available for this crispr