ID: 1123387838

View in Genome Browser
Species Human (GRCh38)
Location 15:19835635-19835657
Sequence GAGTGCTTTGAGTCTTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123387838_1123387840 -9 Left 1123387838 15:19835635-19835657 CCACCAGAAGACTCAAAGCACTC No data
Right 1123387840 15:19835649-19835671 AAAGCACTCAAAATAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123387838 Original CRISPR GAGTGCTTTGAGTCTTCTGG TGG (reversed) Intergenic
No off target data available for this crispr