ID: 1123387840

View in Genome Browser
Species Human (GRCh38)
Location 15:19835649-19835671
Sequence AAAGCACTCAAAATAACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123387837_1123387840 -3 Left 1123387837 15:19835629-19835651 CCTTTTCCACCAGAAGACTCAAA No data
Right 1123387840 15:19835649-19835671 AAAGCACTCAAAATAACCACTGG No data
1123387838_1123387840 -9 Left 1123387838 15:19835635-19835657 CCACCAGAAGACTCAAAGCACTC No data
Right 1123387840 15:19835649-19835671 AAAGCACTCAAAATAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123387840 Original CRISPR AAAGCACTCAAAATAACCAC TGG Intergenic
No off target data available for this crispr