ID: 1123396284

View in Genome Browser
Species Human (GRCh38)
Location 15:19940772-19940794
Sequence CCAGATACACCCCTTTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123396284_1123396289 21 Left 1123396284 15:19940772-19940794 CCATTTCAAAGGGGTGTATCTGG No data
Right 1123396289 15:19940816-19940838 GTTATGTGAGCAAATAAATGGGG No data
1123396284_1123396287 19 Left 1123396284 15:19940772-19940794 CCATTTCAAAGGGGTGTATCTGG No data
Right 1123396287 15:19940814-19940836 AGGTTATGTGAGCAAATAAATGG No data
1123396284_1123396288 20 Left 1123396284 15:19940772-19940794 CCATTTCAAAGGGGTGTATCTGG No data
Right 1123396288 15:19940815-19940837 GGTTATGTGAGCAAATAAATGGG 0: 39
1: 14
2: 1
3: 24
4: 202
1123396284_1123396286 -1 Left 1123396284 15:19940772-19940794 CCATTTCAAAGGGGTGTATCTGG No data
Right 1123396286 15:19940794-19940816 GTGCACTGTGTAGAATAAATAGG 0: 26
1: 27
2: 4
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123396284 Original CRISPR CCAGATACACCCCTTTGAAA TGG (reversed) Intergenic
No off target data available for this crispr