ID: 1123399306

View in Genome Browser
Species Human (GRCh38)
Location 15:19968632-19968654
Sequence TCTCCAGATAGACCACCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123399306_1123399311 -7 Left 1123399306 15:19968632-19968654 CCCGTGGGTGGTCTATCTGGAGA No data
Right 1123399311 15:19968648-19968670 CTGGAGAAGGTTCTGGGTAAAGG No data
1123399306_1123399312 7 Left 1123399306 15:19968632-19968654 CCCGTGGGTGGTCTATCTGGAGA No data
Right 1123399312 15:19968662-19968684 GGGTAAAGGTGTTAGAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123399306 Original CRISPR TCTCCAGATAGACCACCCAC GGG (reversed) Intergenic
No off target data available for this crispr