ID: 1123399400

View in Genome Browser
Species Human (GRCh38)
Location 15:19969466-19969488
Sequence GGCCATTGACAGAGGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123399386_1123399400 27 Left 1123399386 15:19969416-19969438 CCCGTTCTCACCTGGGAACCCTG No data
Right 1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG No data
1123399396_1123399400 -4 Left 1123399396 15:19969447-19969469 CCATGAGAGGTAAATCTAAGGCC No data
Right 1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG No data
1123399390_1123399400 9 Left 1123399390 15:19969434-19969456 CCCTGTGGATGCCCCATGAGAGG No data
Right 1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG No data
1123399393_1123399400 -2 Left 1123399393 15:19969445-19969467 CCCCATGAGAGGTAAATCTAAGG No data
Right 1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG No data
1123399389_1123399400 17 Left 1123399389 15:19969426-19969448 CCTGGGAACCCTGTGGATGCCCC No data
Right 1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG No data
1123399395_1123399400 -3 Left 1123399395 15:19969446-19969468 CCCATGAGAGGTAAATCTAAGGC No data
Right 1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG No data
1123399392_1123399400 8 Left 1123399392 15:19969435-19969457 CCTGTGGATGCCCCATGAGAGGT No data
Right 1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG No data
1123399387_1123399400 26 Left 1123399387 15:19969417-19969439 CCGTTCTCACCTGGGAACCCTGT No data
Right 1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123399400 Original CRISPR GGCCATTGACAGAGGGGCCA TGG Intergenic
No off target data available for this crispr