ID: 1123402517

View in Genome Browser
Species Human (GRCh38)
Location 15:20002759-20002781
Sequence TGCCTTTTACCATAAATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123402517_1123402531 28 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402531 15:20002810-20002832 GCAGGGGGAAGAAGGAAAGGGGG No data
1123402517_1123402524 11 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402524 15:20002793-20002815 GGAGTGTCACATGGTGAGCAGGG No data
1123402517_1123402523 10 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402523 15:20002792-20002814 AGGAGTGTCACATGGTGAGCAGG No data
1123402517_1123402526 13 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402526 15:20002795-20002817 AGTGTCACATGGTGAGCAGGGGG No data
1123402517_1123402529 26 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402529 15:20002808-20002830 GAGCAGGGGGAAGAAGGAAAGGG No data
1123402517_1123402527 20 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG No data
1123402517_1123402522 2 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402522 15:20002784-20002806 GGGGAAGAAGGAGTGTCACATGG No data
1123402517_1123402528 25 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402528 15:20002807-20002829 TGAGCAGGGGGAAGAAGGAAAGG No data
1123402517_1123402521 -10 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402521 15:20002772-20002794 GTAAAAGGCACAGGGGAAGAAGG No data
1123402517_1123402525 12 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402525 15:20002794-20002816 GAGTGTCACATGGTGAGCAGGGG No data
1123402517_1123402530 27 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402530 15:20002809-20002831 AGCAGGGGGAAGAAGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123402517 Original CRISPR TGCCTTTTACCATAAATATA AGG (reversed) Intergenic
No off target data available for this crispr