ID: 1123402527

View in Genome Browser
Species Human (GRCh38)
Location 15:20002802-20002824
Sequence CATGGTGAGCAGGGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123402517_1123402527 20 Left 1123402517 15:20002759-20002781 CCTTATATTTATGGTAAAAGGCA No data
Right 1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123402527 Original CRISPR CATGGTGAGCAGGGGGAAGA AGG Intergenic
No off target data available for this crispr