ID: 1123403261

View in Genome Browser
Species Human (GRCh38)
Location 15:20005956-20005978
Sequence CCGGACCTGGCAGTAGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123403261_1123403280 29 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403280 15:20006008-20006030 AGGAGGTAGCAGGGCACCGAGGG No data
1123403261_1123403272 -2 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403272 15:20005977-20005999 GGGGAAACTCGGGATGTCCAGGG No data
1123403261_1123403271 -3 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403271 15:20005976-20005998 CGGGGAAACTCGGGATGTCCAGG No data
1123403261_1123403281 30 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403281 15:20006009-20006031 GGAGGTAGCAGGGCACCGAGGGG No data
1123403261_1123403274 12 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403274 15:20005991-20006013 TGTCCAGGGCTGACCTGAGGAGG No data
1123403261_1123403276 19 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403276 15:20005998-20006020 GGCTGACCTGAGGAGGTAGCAGG No data
1123403261_1123403277 20 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403277 15:20005999-20006021 GCTGACCTGAGGAGGTAGCAGGG No data
1123403261_1123403279 28 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403279 15:20006007-20006029 GAGGAGGTAGCAGGGCACCGAGG No data
1123403261_1123403273 9 Left 1123403261 15:20005956-20005978 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123403273 15:20005988-20006010 GGATGTCCAGGGCTGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123403261 Original CRISPR CCGGACCTGGCAGTAGGTTT GGG (reversed) Intergenic
No off target data available for this crispr