ID: 1123404144

View in Genome Browser
Species Human (GRCh38)
Location 15:20010401-20010423
Sequence GGCTCCTCCTGGTACTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123404144_1123404149 -3 Left 1123404144 15:20010401-20010423 CCTAGTGAGTACCAGGAGGAGCC No data
Right 1123404149 15:20010421-20010443 GCCTGAAGGGAGCTCCATGGAGG No data
1123404144_1123404151 8 Left 1123404144 15:20010401-20010423 CCTAGTGAGTACCAGGAGGAGCC No data
Right 1123404151 15:20010432-20010454 GCTCCATGGAGGACCTGCCTCGG No data
1123404144_1123404148 -6 Left 1123404144 15:20010401-20010423 CCTAGTGAGTACCAGGAGGAGCC No data
Right 1123404148 15:20010418-20010440 GGAGCCTGAAGGGAGCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123404144 Original CRISPR GGCTCCTCCTGGTACTCACT AGG (reversed) Intergenic
No off target data available for this crispr