ID: 1123405900

View in Genome Browser
Species Human (GRCh38)
Location 15:20019269-20019291
Sequence GGGCCAAGGTCTAGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123405896_1123405900 -7 Left 1123405896 15:20019253-20019275 CCAGATGAATCCTACAGGGCCAA No data
Right 1123405900 15:20019269-20019291 GGGCCAAGGTCTAGGTGTGCTGG No data
1123405889_1123405900 30 Left 1123405889 15:20019216-20019238 CCCAGTGGCTTAAACACCACACA No data
Right 1123405900 15:20019269-20019291 GGGCCAAGGTCTAGGTGTGCTGG No data
1123405892_1123405900 14 Left 1123405892 15:20019232-20019254 CCACACATTTATACCACAGGTCC No data
Right 1123405900 15:20019269-20019291 GGGCCAAGGTCTAGGTGTGCTGG No data
1123405893_1123405900 1 Left 1123405893 15:20019245-20019267 CCACAGGTCCAGATGAATCCTAC No data
Right 1123405900 15:20019269-20019291 GGGCCAAGGTCTAGGTGTGCTGG No data
1123405890_1123405900 29 Left 1123405890 15:20019217-20019239 CCAGTGGCTTAAACACCACACAT No data
Right 1123405900 15:20019269-20019291 GGGCCAAGGTCTAGGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123405900 Original CRISPR GGGCCAAGGTCTAGGTGTGC TGG Intergenic
No off target data available for this crispr