ID: 1123406603

View in Genome Browser
Species Human (GRCh38)
Location 15:20023194-20023216
Sequence GCCTACACCTCCACCATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123406603_1123406606 26 Left 1123406603 15:20023194-20023216 CCATCTATGGTGGAGGTGTAGGC No data
Right 1123406606 15:20023243-20023265 CATTGAACACAACAACATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123406603 Original CRISPR GCCTACACCTCCACCATAGA TGG (reversed) Intergenic
No off target data available for this crispr