ID: 1123407300

View in Genome Browser
Species Human (GRCh38)
Location 15:20028744-20028766
Sequence GCATTTACAGGTGTGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123407294_1123407300 0 Left 1123407294 15:20028721-20028743 CCACCTTGGCCTCCCAAAGTGTT 0: 4221
1: 66343
2: 155330
3: 159343
4: 92549
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407291_1123407300 5 Left 1123407291 15:20028716-20028738 CCCTCCCACCTTGGCCTCCCAAA 0: 167
1: 1142
2: 3246
3: 6046
4: 7232
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407286_1123407300 23 Left 1123407286 15:20028698-20028720 CCTCCTGGCCTCAAGCCACCCTC No data
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407290_1123407300 8 Left 1123407290 15:20028713-20028735 CCACCCTCCCACCTTGGCCTCCC 0: 8
1: 220
2: 803
3: 3084
4: 8657
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407287_1123407300 20 Left 1123407287 15:20028701-20028723 CCTGGCCTCAAGCCACCCTCCCA 0: 8
1: 338
2: 4606
3: 23551
4: 61050
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407295_1123407300 -3 Left 1123407295 15:20028724-20028746 CCTTGGCCTCCCAAAGTGTTGCA 0: 22
1: 727
2: 13851
3: 116827
4: 236335
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407292_1123407300 4 Left 1123407292 15:20028717-20028739 CCTCCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407296_1123407300 -9 Left 1123407296 15:20028730-20028752 CCTCCCAAAGTGTTGCATTTACA No data
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407288_1123407300 15 Left 1123407288 15:20028706-20028728 CCTCAAGCCACCCTCCCACCTTG 0: 4
1: 89
2: 1045
3: 4337
4: 16323
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407285_1123407300 29 Left 1123407285 15:20028692-20028714 CCTCAACCTCCTGGCCTCAAGCC 0: 11
1: 293
2: 3682
3: 15343
4: 51496
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data
1123407293_1123407300 1 Left 1123407293 15:20028720-20028742 CCCACCTTGGCCTCCCAAAGTGT 0: 2536
1: 40105
2: 146028
3: 241222
4: 211356
Right 1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123407300 Original CRISPR GCATTTACAGGTGTGTGCCA AGG Intergenic
No off target data available for this crispr