ID: 1123415700

View in Genome Browser
Species Human (GRCh38)
Location 15:20093470-20093492
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 3, 1: 0, 2: 2, 3: 29, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123415700 Original CRISPR GAGGACAGACAGAAGTCTGC AGG Intergenic
900104113 1:974920-974942 GAGGACAGAGAAAGGTCAGCAGG + Exonic
900193180 1:1360039-1360061 GAGGACGGACAGCAGTTTGGTGG + Intronic
900418059 1:2544044-2544066 GGGGACAGCCAGGAGGCTGCGGG - Intergenic
901603382 1:10440072-10440094 GAGCACAGACAGGAGGCTGGGGG - Intronic
902120806 1:14163936-14163958 GAGGACCAACAGGATTCTGCTGG + Intergenic
903978263 1:27166338-27166360 GAGGAAAGCCAGAAGGTTGCGGG - Intronic
904287642 1:29462353-29462375 GAGGACAGACAGACGTATGCAGG - Intergenic
904398558 1:30240495-30240517 GAGGAGAGATAGAAGGCTGCAGG - Intergenic
906698762 1:47842468-47842490 GAGGAAAGGCAGATGTCTGTAGG - Intronic
907262751 1:53233740-53233762 GATGCCAGAAATAAGTCTGCAGG - Intronic
907524299 1:55045224-55045246 GAAGGCAAACAGAAGGCTGCAGG + Intronic
907648184 1:56265134-56265156 GATGAAAGAGAGAAGTGTGCTGG - Intergenic
908941107 1:69435353-69435375 GAGAACAGAAATAAGTGTGCAGG - Intergenic
909553294 1:76924037-76924059 TAGGAGAGACAGATTTCTGCTGG + Intronic
910216103 1:84846623-84846645 GAGGTCAGTGAGAAGTCTCCTGG + Intronic
911008315 1:93251800-93251822 GAGGAAAGATATAAGTATGCAGG - Intronic
911984269 1:104601180-104601202 GAGGACAGTAAGAAGTATGAAGG - Intergenic
912198575 1:107429031-107429053 GAGGACAGGAAGAAGTCAGAGGG - Intronic
912304923 1:108557677-108557699 GAGGACACAGAGAAGTAAGCAGG - Intergenic
912587657 1:110781209-110781231 GAGGAAAAAGAGAAGTGTGCAGG + Intergenic
912718083 1:111996216-111996238 GAGGACAGAAAGAAGAATGAGGG + Intergenic
915325830 1:155080760-155080782 GAGGACAGAAAGGAGGCTCCCGG - Intronic
916818632 1:168376906-168376928 AAGGACAGACAGAATTGTGGAGG - Intergenic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
917450454 1:175143631-175143653 GAGGGCAGAGAGAAATCTCCTGG + Intronic
917928461 1:179807727-179807749 GAGGACAGACAGGCTCCTGCTGG - Intronic
918072068 1:181140410-181140432 CAGGAGAGGCAGATGTCTGCCGG + Intergenic
920823608 1:209403864-209403886 GAGGACAGACATAAAACTGTTGG + Intergenic
923292352 1:232558448-232558470 GAAGGTAGACAGAGGTCTGCAGG - Intronic
1067199503 10:44155227-44155249 TTGGACATAGAGAAGTCTGCAGG - Intergenic
1067285000 10:44901493-44901515 GAGGACAGCCCAAAGTCAGCTGG - Intergenic
1067471620 10:46542156-46542178 AAGGCCAGGCAGAAGGCTGCAGG + Intergenic
1068763579 10:60738226-60738248 GACTACAGACAGAAATCTGGTGG - Intergenic
1070487239 10:76942786-76942808 AAGTACAGACAGAAGCCAGCAGG - Intronic
1070546544 10:77457285-77457307 GAATGCAGGCAGAAGTCTGCAGG + Intronic
1071714117 10:88077809-88077831 GAGGAGAAAAATAAGTCTGCTGG - Intergenic
1072628896 10:97132236-97132258 GGGGCCAGACTGAAGCCTGCAGG - Intronic
1074431568 10:113399199-113399221 GTGGACATGGAGAAGTCTGCAGG + Intergenic
1075846660 10:125550568-125550590 GAGGTTAAAAAGAAGTCTGCAGG + Intergenic
1075953835 10:126505439-126505461 GAGGAAAGACAGAATTCTGGAGG + Intronic
1077441075 11:2569529-2569551 GAGGACAGGCAGGAGTCCGCCGG + Intronic
1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG + Exonic
1078825624 11:14927458-14927480 AAGGACAGCCACATGTCTGCTGG + Intronic
1078855318 11:15201847-15201869 GAGGACAGAGAGCAGTTTGCTGG - Intronic
1080277974 11:30524336-30524358 GAGGCCAGAGAGAAGTGTGGTGG + Intronic
1081806799 11:45895313-45895335 GAGGAGACACAGATGTGTGCAGG + Intronic
1083051500 11:59780748-59780770 GAAGCCAAACAGAAGTTTGCTGG - Intronic
1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG + Intronic
1088851220 11:113705080-113705102 CAGGGGAGACAGTAGTCTGCAGG - Intronic
1089342952 11:117772054-117772076 GAGGCCAGACATAGGCCTGCCGG - Intronic
1090399784 11:126441620-126441642 GAGAACACACAGAATTATGCAGG + Intronic
1091665332 12:2414817-2414839 GAGGGCAGTCAGGTGTCTGCCGG + Intronic
1091758240 12:3070022-3070044 GAGGATAGCCAGGAGTCTGAAGG + Intergenic
1092251994 12:6904764-6904786 GAGGACAAAAAGAAGTGGGCAGG - Intronic
1094266582 12:28566687-28566709 AGGGACAGACAGAAGTCAGGAGG - Intronic
1094412522 12:30182439-30182461 GATGACAGAAAGCAGACTGCTGG + Intergenic
1095276733 12:40294054-40294076 GAAACCAGACAGAAGTCTGAAGG + Intronic
1095462574 12:42458116-42458138 GAGGACAGACACAAGTCCAATGG - Exonic
1095813156 12:46392816-46392838 GTGGAGCCACAGAAGTCTGCAGG - Intergenic
1098494145 12:71115408-71115430 GAGGACAGAGAGAAGTGCCCTGG - Intronic
1101529582 12:105562066-105562088 TAGTACAGACAGAAATGTGCAGG + Intergenic
1103420056 12:120773459-120773481 GACGGGAGACAGGAGTCTGCGGG + Intronic
1104607375 12:130199936-130199958 GAGGACGGAAAGGAGTATGCAGG + Intergenic
1104845347 12:131844107-131844129 GAGGACAGACAGACCCCAGCGGG - Intronic
1104963983 12:132500905-132500927 GAGGACAGCCAGAGGCCTGCTGG - Intronic
1106980978 13:35279723-35279745 AAGGACAGACTGAAGACTGATGG - Intronic
1110138758 13:72101538-72101560 GAGGACGGACTGGTGTCTGCTGG - Intergenic
1110523285 13:76505863-76505885 GAGGACGGCAAGAAGTATGCTGG - Intergenic
1110656347 13:78004728-78004750 GCGTACAGACAGAAGTCTGTGGG - Intergenic
1113400731 13:109990443-109990465 GGGGACGGACAGAGCTCTGCTGG + Intergenic
1113759248 13:112836041-112836063 GGGGACACACAGAGGGCTGCTGG - Intronic
1114863677 14:26559698-26559720 GAAGACAGAGAGTAGACTGCTGG + Intronic
1115150687 14:30281658-30281680 GATCACAGACAGAAGTATACTGG + Intergenic
1120853701 14:89194592-89194614 GAGGAGAGACAGGAGGCTGTTGG - Intronic
1121450649 14:94004974-94004996 AAGGATAGACAGATGGCTGCGGG + Intergenic
1122389593 14:101371130-101371152 GGGCACAGACAGAAGGATGCTGG + Intergenic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1124339110 15:28878490-28878512 GGGGAGACACAGAAGTGTGCTGG - Intergenic
1124380594 15:29161917-29161939 GAGGACCGACAGACCTCTGAAGG + Intronic
1124425048 15:29556642-29556664 CAGGAGAGACAGAAATGTGCGGG - Intronic
1125344175 15:38702319-38702341 GAGAACAAACAGAAATATGCAGG - Intergenic
1129462855 15:75708551-75708573 GGGGAAAGAGAGAGGTCTGCAGG - Intronic
1129722019 15:77882865-77882887 GGGGAAAGAGAGAGGTCTGCAGG + Intergenic
1129741189 15:77990395-77990417 GAGGCCAGACAGCTGCCTGCAGG - Intronic
1129879287 15:78996416-78996438 GGGGACAGCCAGGGGTCTGCAGG + Intronic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1130760190 15:86811330-86811352 GAGAACAGTCAGAAGGCTACTGG + Intronic
1132240292 15:100252605-100252627 GTTGACAGACAGAGGTCAGCCGG + Intronic
1132679404 16:1133565-1133587 GAGGACAGACAGAGGGAAGCTGG - Intergenic
1132698612 16:1212796-1212818 CAGGACAGCCACAAGCCTGCAGG - Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1134621255 16:15691220-15691242 GAGGACAGACACAGCTGTGCAGG + Exonic
1135541002 16:23330437-23330459 GAGGCCAGACAGGATTCTGAGGG + Intronic
1135594077 16:23728013-23728035 GAGGCAAAACAGAAATCTGCAGG - Intergenic
1135955711 16:26954852-26954874 AGGGACAGACAGAAGACAGCTGG - Intergenic
1136367265 16:29814537-29814559 GAGGACAGACAGGAGAGAGCAGG - Exonic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1138245814 16:55466571-55466593 GAGGACAAACAGAAATCCCCTGG - Intronic
1141097234 16:81171507-81171529 CAAGGCAGACAGAGGTCTGCAGG - Intergenic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1142751494 17:1991131-1991153 TAGAACAGACAGAAATCAGCTGG - Intronic
1143594743 17:7907470-7907492 GGGGACAGAGAGAAGTCAGGTGG + Exonic
1144163029 17:12580392-12580414 AAGGACAGAGAGAAGTCTTTTGG - Intergenic
1144186330 17:12799605-12799627 GCGGAGAGAAAGAAGACTGCTGG - Intronic
1147871187 17:43588766-43588788 GAGGACAGTCAGAAGAGAGCAGG - Intergenic
1148389151 17:47257859-47257881 GAGGAGTGACAGAGGTCTCCTGG + Intronic
1149863154 17:60135501-60135523 GACGACACACAGAAGACTGCGGG + Intergenic
1150425074 17:65070663-65070685 GGGGTCAGAAAGAAGTCGGCTGG + Intergenic
1151390277 17:73782517-73782539 GAGGACAGACAGGAGGTTGTGGG - Intergenic
1153077972 18:1187804-1187826 AGGGAAAGACAGAAGTCTGAAGG - Intergenic
1156490153 18:37491298-37491320 GAGGACAGGCAGGTCTCTGCTGG - Intronic
1158378029 18:56894540-56894562 GAGGAAAGGCAGCAGTTTGCAGG - Intronic
1159831549 18:73284073-73284095 GAGGCAAGAGAGAAGCCTGCAGG - Intergenic
1159973218 18:74678485-74678507 GAGGACAGCCAGCAGGCTGATGG - Intronic
1161935055 19:7366418-7366440 CAGGACATCCAGAAGTCTGCAGG - Intronic
1164236918 19:23345629-23345651 GAGGGTGGACAGCAGTCTGCTGG - Intronic
1164855541 19:31517866-31517888 GAGGACTGACTGCAGTCTGAAGG + Intergenic
1165609064 19:37134417-37134439 CAGGACAGACAGTAGTGTCCAGG + Intronic
1167067479 19:47197503-47197525 GTGGAGAGGCAGAAGTCTACAGG - Intronic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
925123650 2:1438485-1438507 GCTGACAGACAGAAGGCAGCAGG - Intronic
926109584 2:10173477-10173499 GGGGACAGACGGAGGTTTGCGGG - Intronic
926420695 2:12694054-12694076 GATGACAGACAAAATTCCGCAGG - Intergenic
926723849 2:15982548-15982570 GAGGACAGGCAGAAGGATCCAGG + Intergenic
928676488 2:33656230-33656252 GAGAAAAGCCAGAAGTCTGATGG - Intergenic
929002749 2:37364309-37364331 TAGGAGAGGCAGAAATCTGCAGG + Intronic
929941089 2:46334507-46334529 GAAGACAGGGAGAACTCTGCTGG - Intronic
929953767 2:46439263-46439285 GAGCAGAGGAAGAAGTCTGCGGG + Intronic
931777924 2:65556134-65556156 GAAGACAGACGGAAGGCTGATGG + Intergenic
931785390 2:65613436-65613458 GAGAACAGACAGCAGGCTGTAGG + Intergenic
931855252 2:66296251-66296273 GAGGACACCCAGAAGTCCGGAGG - Intergenic
933976772 2:87518417-87518439 GATAACAGACAGAAGGCTGCTGG - Intergenic
934733100 2:96671844-96671866 GAGGACTGAGAGATATCTGCTGG + Intergenic
935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG + Intergenic
936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG + Intergenic
938077581 2:128347965-128347987 GAGCAGAGAAAGAAGACTGCAGG - Intergenic
938143203 2:128812900-128812922 GAGGGCAGGCAGAGGTCTCCAGG + Intergenic
938224886 2:129607075-129607097 GAAGAGAAACAGAAGGCTGCAGG - Intergenic
940192385 2:151055580-151055602 CATGACAGACAGAAGTGTGATGG - Intergenic
941032758 2:160532046-160532068 GAGCACAGACAGGAGCCTGTAGG + Intergenic
942310167 2:174649102-174649124 GATGACAGACATGAATCTGCAGG + Intronic
944499650 2:200346007-200346029 GTAGACAGACAGAGGTCTCCTGG - Intronic
945177748 2:207060623-207060645 GAGGACAGAGAGGAGTCCGCTGG - Intergenic
945557349 2:211295781-211295803 GATGACATACAGAAGTTTGTGGG - Intergenic
946500285 2:220240004-220240026 GAGGAAAGGCAGAAGTTTGTAGG - Intergenic
947331769 2:229036306-229036328 GATGACACACAGAAGCCTGTAGG - Intronic
947437780 2:230087718-230087740 GTGGACAGTCAGATGTCAGCTGG + Intergenic
947811766 2:233009201-233009223 GATGACAGACAGTAGACTGCTGG - Intronic
947942345 2:234069125-234069147 GAGGACATTCAGAAGTCTTATGG - Intronic
948514845 2:238497547-238497569 CAGGACAGGCTGAAGTCAGCAGG - Intergenic
948677581 2:239607835-239607857 GAGGACAGGGAGAAGGTTGCTGG + Intergenic
1169755549 20:9039532-9039554 GAGGATAGAAGGAAGTCGGCTGG + Intergenic
1169867164 20:10214515-10214537 GAGGGCAGAAAGGAGTCTGATGG + Intergenic
1170314694 20:15030139-15030161 GTGGTCAGTCAGAAATCTGCTGG - Intronic
1170525058 20:17228365-17228387 GAGGACAGAGAGAAGGGCGCTGG + Intronic
1171204756 20:23270185-23270207 CAGGACAGACAGAAGTGTCTGGG + Intergenic
1172305367 20:33876639-33876661 GCGGTCAGACAGACGTCTTCTGG - Intergenic
1172531801 20:35636172-35636194 CAGGATGGTCAGAAGTCTGCAGG - Intronic
1172577693 20:36021923-36021945 GAGGAGAAACAGAGGCCTGCAGG + Intronic
1172991329 20:39039084-39039106 GAGGACAGACAGAAGCCACTGGG - Exonic
1173070193 20:39756866-39756888 GAGGACAGAGAGCAGTCCCCTGG - Intergenic
1173360453 20:42339695-42339717 GGGGACAGGCAGGACTCTGCAGG + Intronic
1174162486 20:48561547-48561569 GAGGACAGACTGAAGACCCCTGG + Intergenic
1174979348 20:55375619-55375641 GAGGAAAGTCAGAAGTCTAGTGG - Intergenic
1175297828 20:57921361-57921383 GAGGAAAGACAGAAGTCATATGG - Intergenic
1175299790 20:57934668-57934690 GAAGACTGACAGATGTGTGCTGG - Intergenic
1177512554 21:22108768-22108790 GAGGGCAGACAGAAGACCACTGG + Intergenic
1178239397 21:30881525-30881547 GATGTCAGACAGAGGGCTGCAGG + Exonic
1179416451 21:41202449-41202471 GAGGACAGGCTTGAGTCTGCTGG + Intronic
1179673053 21:42963128-42963150 GAGGATAGAAAGAAGCTTGCGGG - Intergenic
1180245578 21:46545419-46545441 GAGGACACACAGGGGTGTGCAGG - Intronic
1180973157 22:19826306-19826328 GAAGACAGACTGAAGTGTGGGGG - Intronic
1180985722 22:19903053-19903075 GAGGACAGACAGCAGCAGGCTGG + Intronic
1181425540 22:22835264-22835286 GAGGAGAGTCAGAAGTCTCAGGG - Intronic
1181473317 22:23153983-23154005 GAAGACAAACAGAAGTGGGCCGG - Intronic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1181843964 22:25691016-25691038 GAGTACAGAGAGAAGTCCTCAGG - Intronic
1182016193 22:27041924-27041946 GAGGAGAGCCAGAAGCCTCCAGG - Intergenic
1182353678 22:29712631-29712653 GAGGACAGACAGATGGCAGAGGG - Intergenic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1184129937 22:42511759-42511781 GAAGGCAGACACAAGTCTGCAGG + Exonic
1184140107 22:42573574-42573596 GAAGGCAGACACAAGTCTGCAGG + Intronic
1184476698 22:44726000-44726022 GAGTCCAGACAAAAGTCCGCAGG - Intronic
1185404007 22:50635598-50635620 GCGGACACACAGATGTCTCCAGG - Intergenic
949774001 3:7610978-7611000 AAGGACAGACAGAATACTACTGG - Intronic
949796200 3:7854054-7854076 GAAGACAGACAACAGGCTGCTGG + Intergenic
949855362 3:8456546-8456568 AAAGACAAACAGAAGTCAGCTGG + Intergenic
950235746 3:11318799-11318821 GGAGACAGAGAGATGTCTGCAGG - Intronic
950602802 3:14049760-14049782 GAGGACAGACCTAAGGATGCAGG + Intronic
951636422 3:24783304-24783326 AAGGACAGGCAGATGTCTGTTGG - Intergenic
952580557 3:34828517-34828539 GTGGACAGAGAGAAGCCTGGGGG + Intergenic
953916247 3:46922848-46922870 GAAGACAGACACAAGCCTCCCGG + Intronic
954287527 3:49629579-49629601 GAGGACAGACTGGCATCTGCAGG - Intronic
956068078 3:65418160-65418182 GAGGATGGACAACAGTCTGCTGG - Intronic
956917087 3:73883096-73883118 GAGCACAGAAACTAGTCTGCTGG + Intergenic
957313347 3:78546713-78546735 GAGGACAGAATGGAGTCTGCAGG + Intergenic
957514099 3:81229246-81229268 GTGAACAGCCAAAAGTCTGCAGG + Intergenic
961243003 3:125428662-125428684 TAGGACAGCCAGAAGCTTGCTGG - Intergenic
964088294 3:152844936-152844958 GAGGACAAAAAAGAGTCTGCTGG + Intergenic
964847752 3:161062173-161062195 GAGGACTCAAAAAAGTCTGCTGG - Intronic
967014624 3:185470533-185470555 GAGGAAAGACAGAGCTCAGCAGG - Intronic
967046883 3:185745611-185745633 GAGGACAGACAGAAGACGGTTGG - Intronic
967764349 3:193261955-193261977 GAGGACAGACAGAAGGATAGTGG + Intronic
967855578 3:194115076-194115098 GGGGACACACAGGAGGCTGCAGG - Intergenic
967858977 3:194137690-194137712 GAGCACAGACCCAAGTGTGCTGG + Exonic
967920217 3:194608957-194608979 GATGACAGCCAGGAGGCTGCTGG + Intronic
968116121 3:196091285-196091307 TAGTACAGACGGAAGTTTGCTGG + Intergenic
968283793 3:197496414-197496436 CAGGACAGACAGCAGACAGCAGG - Intergenic
968950843 4:3690640-3690662 GAGTACAGACACACGTCAGCCGG - Intergenic
969483470 4:7459004-7459026 GGGGTCAGAGAGAAGCCTGCTGG + Intronic
970111593 4:12643754-12643776 GAGGACACTCAAATGTCTGCTGG - Intergenic
970764998 4:19537901-19537923 GAGAACAGACAGAGTTCTGGAGG - Intergenic
971425073 4:26507929-26507951 GAGGACAGACAGATGGTTGCAGG - Intergenic
975683220 4:76896777-76896799 GAGGAAAGACAGGGGTCTGGCGG + Exonic
978392017 4:108236848-108236870 GAGGCCAGAAAGAAGCCTACTGG + Intergenic
980179405 4:129385841-129385863 AAGGAAAGACAGAATTATGCAGG - Intergenic
980285651 4:130775860-130775882 AAGAACATACAGAACTCTGCAGG - Intergenic
982678941 4:158407299-158407321 GAGGACAAACAGAAACATGCAGG + Intronic
986024690 5:3839641-3839663 GAGGCAAGACAGAAGACAGCAGG - Intergenic
988298413 5:29393231-29393253 GATGAGAGACAGAAGTGTGTAGG - Intergenic
989341666 5:40382648-40382670 GAGGATAAACAGATGCCTGCAGG + Intergenic
995011377 5:107260201-107260223 ATGGCCAGGCAGAAGTCTGCTGG - Intergenic
995914810 5:117232180-117232202 GAAGAGATACAGAAGGCTGCAGG + Intergenic
996927322 5:128843132-128843154 TATTACAGACAGAAGTCTGGAGG + Intronic
997452665 5:133996094-133996116 CTGGACAGACAGAAGTCAGAGGG + Intronic
997529083 5:134571129-134571151 GAGGCCAGACAGATGTCCGCAGG - Intronic
997658660 5:135573859-135573881 GAGGACAGACATAAGACCCCAGG + Intronic
998218695 5:140257378-140257400 TAAGACAGAAATAAGTCTGCTGG - Intronic
998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG + Intronic
999255263 5:150206513-150206535 GAGGAGAGGCAGTAGTGTGCTGG - Intronic
999472520 5:151868140-151868162 GAGTTGAGACAGAAGTCTCCAGG - Intronic
1000374339 5:160565504-160565526 GAGGACAGACTGATATGTGCCGG - Exonic
1001246355 5:170108170-170108192 GAAGACAGAGAGCAGTCTCCCGG + Exonic
1001299857 5:170525697-170525719 GAGGACAGGCAGGAGTGTTCTGG + Intronic
1002758825 6:186031-186053 CAAGACAGACATGAGTCTGCTGG - Intergenic
1004023653 6:11798110-11798132 GAGCAAGGACAGAATTCTGCAGG + Intronic
1004773015 6:18807614-18807636 GAGGAAAGACAGAAATCTGCAGG - Intergenic
1005843893 6:29762805-29762827 GAGGACAGCCAGACATCTGAAGG + Intergenic
1006498996 6:34445428-34445450 GATGACAGCCAGATGTTTGCTGG + Intergenic
1006869677 6:37240058-37240080 GAGGCGAGACAGAAAACTGCTGG + Intronic
1007214779 6:40228467-40228489 AGGGACAGACTGAAGTCTGAGGG + Intergenic
1007228337 6:40330269-40330291 GAGGACAGTGAGAAGGCTGCTGG - Intergenic
1008942913 6:57066579-57066601 GAGGACAGACAAAAGGGGGCTGG + Intergenic
1009489665 6:64273957-64273979 GAGAACAGAAAGGAGTCTGGAGG - Intronic
1011700697 6:89951624-89951646 GAGGACTGCGAGAACTCTGCAGG - Exonic
1015068424 6:129059018-129059040 GAAGAGAGACTGAAGTCTGTCGG - Intronic
1016677837 6:146792732-146792754 GAGGAAAGATAAAAGTCAGCAGG + Intronic
1016983674 6:149877540-149877562 GAGGAGGGGCAGAAGTCTGTGGG - Intergenic
1017120600 6:151020348-151020370 GCGGCCAGACAGCAGTGTGCTGG + Intronic
1017773733 6:157663489-157663511 GATGACAGAGAAGAGTCTGCTGG - Intronic
1018101156 6:160441643-160441665 GAGAACACACAGAAGTCTACTGG + Intronic
1018310656 6:162504874-162504896 GAGGAAAGACAGAACTAGGCAGG + Intronic
1018357130 6:163029476-163029498 GAGGAAAGGGAGAAGTGTGCTGG - Intronic
1019435958 7:1022211-1022233 GAGGACAGACGCAGGCCTGCGGG + Intronic
1019472437 7:1228055-1228077 CAGGAGAGAGAGAACTCTGCAGG + Intergenic
1019970246 7:4534927-4534949 GAGGACAGACAGCAGTGTACAGG - Intergenic
1020405462 7:7828561-7828583 GTGTACACACAGAAGTCAGCAGG - Intronic
1021070332 7:16230908-16230930 GAGGACTGACACAAGTCTGGTGG + Intronic
1022520580 7:31004377-31004399 GAGAAAAGACAGAAGTCAGCTGG - Intergenic
1023063740 7:36354200-36354222 CAGGACATACAGCAGGCTGCAGG - Intronic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1027559941 7:79717127-79717149 AAGGAGAGACAGGAGTCTGAAGG + Intergenic
1029239077 7:99145699-99145721 TAGGACAGGCACAAGGCTGCAGG - Intergenic
1029530773 7:101123800-101123822 GTGGACAGCCAGAGCTCTGCAGG - Intergenic
1029585828 7:101470436-101470458 GAAGAAAGACAGAAGCTTGCAGG - Intronic
1030251753 7:107452942-107452964 TAAGACAGACACTAGTCTGCAGG - Intronic
1030641370 7:112010310-112010332 GAGGAAAGACAGAAGTCATTTGG + Intronic
1032003750 7:128283834-128283856 GAGGACTGAAAGAAGGCTGGTGG - Intergenic
1032852998 7:135811122-135811144 GAGGTCACACAGCAGACTGCAGG + Intergenic
1032880347 7:136083423-136083445 GATGAAAGACAGAAGTTAGCAGG - Intergenic
1033419286 7:141192249-141192271 GAGGACAGGCAGAGGGCTCCAGG + Intronic
1033757529 7:144407386-144407408 AAAGACAGGCAGAAATCTGCAGG + Intronic
1034103846 7:148473921-148473943 GAGGACAGACAAAAGTCCTCTGG - Intergenic
1034839924 7:154386311-154386333 GAAGACAGACAGAAGCATGGTGG - Intronic
1035004548 7:155645130-155645152 GAGGACACACAGAAGTTCACAGG - Intronic
1035406586 7:158602629-158602651 GAGGACCCACAGGAGTCTCCAGG + Intergenic
1035689745 8:1552236-1552258 GAGGATAGAAGGACGTCTGCAGG + Intronic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1037723802 8:21466921-21466943 AAGGAAAGACAGGAATCTGCTGG - Intergenic
1039377987 8:37056438-37056460 AAGGACAGAGAAAACTCTGCTGG + Intergenic
1040300064 8:46183348-46183370 CAGGACAGACAGGAGGCTTCTGG + Intergenic
1040820967 8:51556634-51556656 GAAGACAGACAGAACTCAGCTGG - Intronic
1043472312 8:80575257-80575279 GCGGACAGACAGATGCCTTCTGG - Intergenic
1044299784 8:90570007-90570029 GAGGACATACTGAAATCTTCTGG - Intergenic
1046804868 8:118469046-118469068 GTGGACAGGCAGAAATGTGCTGG - Intronic
1047993747 8:130313931-130313953 GAGGGAAGCCAGCAGTCTGCAGG - Intronic
1049836925 8:144741960-144741982 GATGAAAGACAGAAATCTACAGG + Intronic
1050149673 9:2607053-2607075 GGGGACAGACAGAGTTGTGCTGG - Intergenic
1051914943 9:22197456-22197478 GAGGACAGGAAGAAGTTTGAAGG + Intergenic
1053106451 9:35413185-35413207 TAGGACAGAGAGAACTCTGAAGG - Intergenic
1053122331 9:35556379-35556401 GGGGACAGACAAAACTCAGCTGG - Exonic
1055805150 9:80084672-80084694 GATGACAGAAAGAAGTCTGAAGG + Intergenic
1055966308 9:81868419-81868441 GAGTACAGTCAGATGTCAGCTGG - Intergenic
1056242626 9:84663670-84663692 GAGGAAAGAGAGAAGTAGGCAGG - Intergenic
1057297537 9:93858237-93858259 GAGTACAGAGAGAAATCTGATGG - Intergenic
1059404516 9:114091823-114091845 GAGGTCACACAGCAGTCTCCTGG + Exonic
1059763776 9:117363852-117363874 GAGAAAAGATAGATGTCTGCCGG - Intronic
1060163903 9:121392780-121392802 TATGACAGACAGAAGTATGATGG - Intergenic
1060760285 9:126241437-126241459 GAGGACAGACAGTAGCCACCTGG - Intergenic
1061322370 9:129839373-129839395 GAGGAGACACAGAAGTGTGTGGG + Intronic
1062452129 9:136620244-136620266 GAGGACAGCCTGGAGTGTGCAGG + Intergenic
1062649591 9:137568730-137568752 GGGAACAGAAAGAAGCCTGCAGG + Intronic
1186631289 X:11351650-11351672 CCGGACCGTCAGAAGTCTGCTGG + Intronic
1187038246 X:15565269-15565291 CAAGACAGACACAAGTCTTCTGG + Intronic
1187847556 X:23556589-23556611 GAGGACAGACATATGGCTACAGG + Intergenic
1189301945 X:39958513-39958535 GAGGGAAGAGAGAAGTCTTCGGG - Intergenic
1191073567 X:56428461-56428483 GAGGACAGCCAGAGATATGCTGG - Intergenic
1192048161 X:67698364-67698386 CTGGACAAACAGAATTCTGCAGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1195026266 X:100880699-100880721 GAGGACAGACACAAGTGATCAGG - Intergenic
1199848986 X:151711836-151711858 AAGGACAGACAGAAGGATTCAGG - Intergenic
1199976847 X:152899234-152899256 TACGACAGCCAGAAGTCTGAAGG - Intergenic