ID: 1123421614

View in Genome Browser
Species Human (GRCh38)
Location 15:20140684-20140706
Sequence GACACCTCCAAGTCCAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123421611_1123421614 7 Left 1123421611 15:20140654-20140676 CCAACGTTGGGGCAGGGCAAATC No data
Right 1123421614 15:20140684-20140706 GACACCTCCAAGTCCAGCTCTGG No data
1123421605_1123421614 23 Left 1123421605 15:20140638-20140660 CCAGAGCAGGGCTGGGCCAACGT No data
Right 1123421614 15:20140684-20140706 GACACCTCCAAGTCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123421614 Original CRISPR GACACCTCCAAGTCCAGCTC TGG Intergenic
No off target data available for this crispr