ID: 1123421617

View in Genome Browser
Species Human (GRCh38)
Location 15:20140695-20140717
Sequence GTCCAGCTCTGGCCCTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123421613_1123421617 -8 Left 1123421613 15:20140680-20140702 CCAGGACACCTCCAAGTCCAGCT No data
Right 1123421617 15:20140695-20140717 GTCCAGCTCTGGCCCTGCCTTGG No data
1123421611_1123421617 18 Left 1123421611 15:20140654-20140676 CCAACGTTGGGGCAGGGCAAATC No data
Right 1123421617 15:20140695-20140717 GTCCAGCTCTGGCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123421617 Original CRISPR GTCCAGCTCTGGCCCTGCCT TGG Intergenic
No off target data available for this crispr