ID: 1123421619

View in Genome Browser
Species Human (GRCh38)
Location 15:20140701-20140723
Sequence CTCTGGCCCTGCCTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123421611_1123421619 24 Left 1123421611 15:20140654-20140676 CCAACGTTGGGGCAGGGCAAATC No data
Right 1123421619 15:20140701-20140723 CTCTGGCCCTGCCTTGGCCCTGG No data
1123421615_1123421619 -10 Left 1123421615 15:20140688-20140710 CCTCCAAGTCCAGCTCTGGCCCT No data
Right 1123421619 15:20140701-20140723 CTCTGGCCCTGCCTTGGCCCTGG No data
1123421613_1123421619 -2 Left 1123421613 15:20140680-20140702 CCAGGACACCTCCAAGTCCAGCT No data
Right 1123421619 15:20140701-20140723 CTCTGGCCCTGCCTTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123421619 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG Intergenic
No off target data available for this crispr