ID: 1123422751

View in Genome Browser
Species Human (GRCh38)
Location 15:20145177-20145199
Sequence GGCTGCACTCCTTGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123422745_1123422751 -7 Left 1123422745 15:20145161-20145183 CCATTGGGCCCACTGGGGCTGCA No data
Right 1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG No data
1123422736_1123422751 9 Left 1123422736 15:20145145-20145167 CCCCACTCCACAGGAACCATTGG No data
Right 1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG No data
1123422734_1123422751 16 Left 1123422734 15:20145138-20145160 CCCAGCTCCCCACTCCACAGGAA No data
Right 1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG No data
1123422738_1123422751 8 Left 1123422738 15:20145146-20145168 CCCACTCCACAGGAACCATTGGG No data
Right 1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG No data
1123422740_1123422751 7 Left 1123422740 15:20145147-20145169 CCACTCCACAGGAACCATTGGGC No data
Right 1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG No data
1123422732_1123422751 24 Left 1123422732 15:20145130-20145152 CCACAGCACCCAGCTCCCCACTC No data
Right 1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG No data
1123422741_1123422751 2 Left 1123422741 15:20145152-20145174 CCACAGGAACCATTGGGCCCACT No data
Right 1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG No data
1123422735_1123422751 15 Left 1123422735 15:20145139-20145161 CCAGCTCCCCACTCCACAGGAAC No data
Right 1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123422751 Original CRISPR GGCTGCACTCCTTGGGGAGC AGG Intergenic
No off target data available for this crispr