ID: 1123427152

View in Genome Browser
Species Human (GRCh38)
Location 15:20182054-20182076
Sequence ATGAACGCCTCCTCGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123427152_1123427159 12 Left 1123427152 15:20182054-20182076 CCCATCCCCGAGGAGGCGTTCAT No data
Right 1123427159 15:20182089-20182111 TATCTCTCCATCGTTCCTATGGG No data
1123427152_1123427158 11 Left 1123427152 15:20182054-20182076 CCCATCCCCGAGGAGGCGTTCAT No data
Right 1123427158 15:20182088-20182110 CTATCTCTCCATCGTTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123427152 Original CRISPR ATGAACGCCTCCTCGGGGAT GGG (reversed) Intergenic