ID: 1123427208

View in Genome Browser
Species Human (GRCh38)
Location 15:20182644-20182666
Sequence AGCAACTTGAAGCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123427208_1123427213 30 Left 1123427208 15:20182644-20182666 CCCTCACCAGGCTTCAAGTTGCT No data
Right 1123427213 15:20182697-20182719 CAAATATGTTCTGGAGATTTCGG No data
1123427208_1123427212 21 Left 1123427208 15:20182644-20182666 CCCTCACCAGGCTTCAAGTTGCT No data
Right 1123427212 15:20182688-20182710 AAATAATTTCAAATATGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123427208 Original CRISPR AGCAACTTGAAGCCTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr