ID: 1123428595

View in Genome Browser
Species Human (GRCh38)
Location 15:20194152-20194174
Sequence GTTAGAGCCCTGATAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123428595_1123428608 25 Left 1123428595 15:20194152-20194174 CCTCCCATTATCAGGGCTCTAAC No data
Right 1123428608 15:20194200-20194222 CTGGAAAGTCCAAGGGAAAAAGG No data
1123428595_1123428605 18 Left 1123428595 15:20194152-20194174 CCTCCCATTATCAGGGCTCTAAC No data
Right 1123428605 15:20194193-20194215 CTACCCTCTGGAAAGTCCAAGGG No data
1123428595_1123428601 6 Left 1123428595 15:20194152-20194174 CCTCCCATTATCAGGGCTCTAAC No data
Right 1123428601 15:20194181-20194203 CTGCCCTCTGTTCTACCCTCTGG No data
1123428595_1123428604 17 Left 1123428595 15:20194152-20194174 CCTCCCATTATCAGGGCTCTAAC No data
Right 1123428604 15:20194192-20194214 TCTACCCTCTGGAAAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123428595 Original CRISPR GTTAGAGCCCTGATAATGGG AGG (reversed) Intergenic
No off target data available for this crispr