ID: 1123432173

View in Genome Browser
Species Human (GRCh38)
Location 15:20227433-20227455
Sequence CCTAACCAGCACCAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123432173_1123432178 -3 Left 1123432173 15:20227433-20227455 CCAACCAGCTGGTGCTGGTTAGG No data
Right 1123432178 15:20227453-20227475 AGGATTAGACCAGTGGGAGTTGG No data
1123432173_1123432179 -2 Left 1123432173 15:20227433-20227455 CCAACCAGCTGGTGCTGGTTAGG No data
Right 1123432179 15:20227454-20227476 GGATTAGACCAGTGGGAGTTGGG No data
1123432173_1123432180 -1 Left 1123432173 15:20227433-20227455 CCAACCAGCTGGTGCTGGTTAGG No data
Right 1123432180 15:20227455-20227477 GATTAGACCAGTGGGAGTTGGGG No data
1123432173_1123432177 -9 Left 1123432173 15:20227433-20227455 CCAACCAGCTGGTGCTGGTTAGG No data
Right 1123432177 15:20227447-20227469 CTGGTTAGGATTAGACCAGTGGG No data
1123432173_1123432182 8 Left 1123432173 15:20227433-20227455 CCAACCAGCTGGTGCTGGTTAGG No data
Right 1123432182 15:20227464-20227486 AGTGGGAGTTGGGGTTGAAAAGG No data
1123432173_1123432176 -10 Left 1123432173 15:20227433-20227455 CCAACCAGCTGGTGCTGGTTAGG No data
Right 1123432176 15:20227446-20227468 GCTGGTTAGGATTAGACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123432173 Original CRISPR CCTAACCAGCACCAGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr