ID: 1123434518

View in Genome Browser
Species Human (GRCh38)
Location 15:20245309-20245331
Sequence GCCCCCTTTATCCCCCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434515_1123434518 11 Left 1123434515 15:20245275-20245297 CCGGACAGACTCCATTTTAGTTT 0: 23
1: 16
2: 9
3: 33
4: 360
Right 1123434518 15:20245309-20245331 GCCCCCTTTATCCCCCTTAAGGG No data
1123434516_1123434518 0 Left 1123434516 15:20245286-20245308 CCATTTTAGTTTCTTCACTTGCA No data
Right 1123434518 15:20245309-20245331 GCCCCCTTTATCCCCCTTAAGGG No data
1123434514_1123434518 25 Left 1123434514 15:20245261-20245283 CCTAGCAGAGAGAGCCGGACAGA No data
Right 1123434518 15:20245309-20245331 GCCCCCTTTATCCCCCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434518 Original CRISPR GCCCCCTTTATCCCCCTTAA GGG Intergenic
No off target data available for this crispr