ID: 1123434677

View in Genome Browser
Species Human (GRCh38)
Location 15:20246605-20246627
Sequence CTTTGGGAGGCTGAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 595045
Summary {0: 23522, 1: 76482, 2: 160024, 3: 176046, 4: 158971}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434677_1123434684 -8 Left 1123434677 15:20246605-20246627 CCTCCCACCTCAGCCTCCCAAAG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
Right 1123434684 15:20246620-20246642 TCCCAAAGTGCTGGGATTGCAGG 0: 5331
1: 293072
2: 261128
3: 150078
4: 131612
1123434677_1123434689 21 Left 1123434677 15:20246605-20246627 CCTCCCACCTCAGCCTCCCAAAG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434677_1123434687 17 Left 1123434677 15:20246605-20246627 CCTCCCACCTCAGCCTCCCAAAG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
Right 1123434687 15:20246645-20246667 TGAGCCACCACACCCAGCCAAGG 0: 100
1: 668
2: 2148
3: 4495
4: 7061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434677 Original CRISPR CTTTGGGAGGCTGAGGTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr