ID: 1123434678

View in Genome Browser
Species Human (GRCh38)
Location 15:20246608-20246630
Sequence GCACTTTGGGAGGCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 875625
Summary {0: 31080, 1: 132897, 2: 232009, 3: 232314, 4: 247325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434678_1123434689 18 Left 1123434678 15:20246608-20246630 CCCACCTCAGCCTCCCAAAGTGC 0: 31080
1: 132897
2: 232009
3: 232314
4: 247325
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434678_1123434687 14 Left 1123434678 15:20246608-20246630 CCCACCTCAGCCTCCCAAAGTGC 0: 31080
1: 132897
2: 232009
3: 232314
4: 247325
Right 1123434687 15:20246645-20246667 TGAGCCACCACACCCAGCCAAGG 0: 100
1: 668
2: 2148
3: 4495
4: 7061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434678 Original CRISPR GCACTTTGGGAGGCTGAGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr