ID: 1123434679

View in Genome Browser
Species Human (GRCh38)
Location 15:20246609-20246631
Sequence AGCACTTTGGGAGGCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557090
Summary {0: 60215, 1: 147830, 2: 155736, 3: 113395, 4: 79914}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434679_1123434694 30 Left 1123434679 15:20246609-20246631 CCACCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1123434694 15:20246662-20246684 CCAAGGAAGGCTTTGTGATATGG No data
1123434679_1123434689 17 Left 1123434679 15:20246609-20246631 CCACCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434679_1123434687 13 Left 1123434679 15:20246609-20246631 CCACCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1123434687 15:20246645-20246667 TGAGCCACCACACCCAGCCAAGG 0: 100
1: 668
2: 2148
3: 4495
4: 7061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434679 Original CRISPR AGCACTTTGGGAGGCTGAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr