ID: 1123434681

View in Genome Browser
Species Human (GRCh38)
Location 15:20246612-20246634
Sequence CCCAGCACTTTGGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1083691
Summary {0: 84188, 1: 205795, 2: 234195, 3: 260821, 4: 298692}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123434681_1123434687 10 Left 1123434681 15:20246612-20246634 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1123434687 15:20246645-20246667 TGAGCCACCACACCCAGCCAAGG 0: 100
1: 668
2: 2148
3: 4495
4: 7061
1123434681_1123434689 14 Left 1123434681 15:20246612-20246634 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1123434689 15:20246649-20246671 CCACCACACCCAGCCAAGGAAGG No data
1123434681_1123434694 27 Left 1123434681 15:20246612-20246634 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1123434694 15:20246662-20246684 CCAAGGAAGGCTTTGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123434681 Original CRISPR CCCAGCACTTTGGGAGGCTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr